Labshake search
Citations for Becton, Dickinson and Company :
801 - 850 of 7208 citations for Cow Cysteine rich protein 1 CRIP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and analyzed with CBA analysis kit (BD, Carlsbad, CA), according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... A cytometric bead-based multiplex assay kit (BD Biosciences) was used to measure the concentration of IFN-γ ...
-
bioRxiv - Immunology 2020Quote: ... was performed using the Cytofix/Cytoperm kit (BD Biosciences) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and stained with a Phosflow staining kit (BD Biosciences) using the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... according to the manufacturer’s protocol (BD Cytofix/Cytoperm kit).
-
bioRxiv - Immunology 2022Quote: ... following the BrdU Flow Kit manufacturer’s instructions (BD Pharmingen). For Ki67 analysis ...
-
bioRxiv - Immunology 2022Quote: ... and treated with a Cytofix/Cytoperm kit (BD Biosciences) per manufacturer protocol.
-
bioRxiv - Immunology 2022Quote: A human Th1/Th2/Th17 Cytokine Kit (BD Biosciences) was used to measure the production of cytokines as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... fixed/permeabalized using the BD cytofix/cytoperm kit (BD), and stained with anti-IFNγ (XMG1.2 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The Cytokine Bead Array kit was procured from BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... using Cytofix/Cytoperm Fixation/Permeabilization Solution kit (BD Biosciences) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Viability was analyzed with Kit 7AAD/Annexin (BD Pharmingen), according to the manufacturer’s instructions ...
-
IRF1 regulates self-renewal and stress-responsiveness to support hematopoietic stem cell maintenancebioRxiv - Cell Biology 2023Quote: BD Annexin V: FITC Detection kit I (BD Pharmingen) was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... intracellular staining was performed using Citofix/CytopermTM kit (BD) following manufacturer instructions and using the following antibodies ...
-
bioRxiv - Immunology 2023Quote: ... the BD Cytofix/Cytoperm kit (BD Biosciences Cat. 554714) and FOXP3 Transcription Factor Staining Buffer set (eBioscience Cat ...
-
bioRxiv - Immunology 2023Quote: ... CytoFix/CytoPerm and Perm/Wash Buffer kit (BD, 554714) was used for intracellular staining steps ...
-
bioRxiv - Immunology 2022Quote: ... fixed and permeabilized with Cytofix/Cytoperm kit (BD Biosciences) prior to acquisition using FACSymphony ...
-
bioRxiv - Immunology 2023Quote: ... by using Cytofix/CytoPerm Plus kit (555028; BD Pharmingen). Samples were analyzed using a Fortessa flow cytometer (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized using the Fixation/Permeabilization Kit (BD Biosciences #554714), and stained intracellularly ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized using a Cytofix/Cytoperm solution kit (BD Biosciences), and intracellularly stained with anti-TNF-Alexa 700 (alone MAB11) ...
-
bioRxiv - Immunology 2023Quote: ... FITC-anti-BrdU (BD, BrdU flow kit, Cat#559619), Zombie Aqua fixable viability kit (BioLegend ...
-
bioRxiv - Pathology 2023Quote: ... WBC were quantified using the Leucocount Kit (BD, 340523). Platelet unit pH was measured daily by adding 25 μL of the platelet unit to pH strips with a pH range of 5-9 (Fisher ...
-
bioRxiv - Developmental Biology 2024Quote: ... labeled with Mouse Immune Single-Cell Multiplexing Kit (BD) and loaded on a microwell cartridge of the BD Rhapsody Express system (BD ...
-
bioRxiv - Immunology 2024Quote: ... or Cytofix/Cytoperm Fixation/Permeabilization Solution Kit (BD Bioscences). Final flow cytometry gating strategy for SFCs and PBMCs shown in Suppl ...
-
bioRxiv - Immunology 2024Quote: ... cells were fixed using BD Cytofix kit (BD #554655) following manufacturer’s instructions and acquired on analyzer within 3 days of fixation ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was generated using the cDNA kit from BD. Libraries were prepared using the whole transcriptome analysis (WTA ...
-
bioRxiv - Immunology 2024Quote: ... and processed using BD Rhapsody Cartridge Reagent Kit (BD) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... at 5:1:1 concentration ratio before transferred into a 1 ml syringe with BD Luer-Lok (BD, 309628, NJ, USA). The syringe was then hanged vertically to allow cell settling by gravity for 10-15 min with no flow ...
-
bioRxiv - Neuroscience 2020Quote: ... one section out of ten was incubated with BrdU antibodies (BrdU, 1/1,000, CldU, 1/500, Accurate Chemical; IdU, 1/500, BD Bioscience). Bound antibodies were visualized with Cy3-goat anti-rat antibodies (1/1,000 ...
-
bioRxiv - Microbiology 2022Quote: ... were grown in in Pro99 media supplemented with 5 g L-1 peptone and 1 g L-1 yeast extract (BD Difco). All heterotrophs were grown at 24 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... were subcutaneously inoculated with 1 × 106 LoVo or 2 × 106 LS180 cells in 1:1 mixture of PBS and matrigel (BD Biosciences) into lower right flank ...
-
bioRxiv - Immunology 2020Quote: ... A fixable Viability Dye (APC-eFluor780 1:200, 1:400) (eBioscience, Germany) or ViaProbe (7-AAD, 1:33) (BD Biosciences, Germany)) was used for live/dead discrimination ...
-
bioRxiv - Immunology 2020Quote: ... RORγt (AFKJS-9; PE, dil. 1:100) (eBioscience); CD25 (PC61; PerCP, dil. 1:400), CD103 (M290; PE, dil. 1:150) (BD Pharmingen); CD11b (M1/70 ...
-
bioRxiv - Pathology 2020Quote: ... KI67 (1/1000, 14-5698-82, Ebioscience), NANOG (1/200, 49035, cell signaling technology) and OCT3/4 (1/200, 561556, BD Biosciences). The next day ...
-
bioRxiv - Immunology 2019Quote: ... after which cells were stained with Fixable Viability Staining e780 (1:1000) and CD11B (M1/70) antibodies: CD11B-BV510 (Day 1 cells, 1:300, BD Biosciences), CD11B-Percp-Cy5.5 (Day 3 cells ...
-
bioRxiv - Immunology 2021Quote: ... as a negative control in the presence of αCD28/αCD49d co-Stim antibodies (1 μg ml−1) GolgiStop (containing Monensin, 2 μmol/L), GolgiPlug (containing brefeldin A, 10 μg ml−1) (BD Biosciences) and anti-CD107α BV421 antibody (BD Biosciences) ...
-
bioRxiv - Bioengineering 2024Quote: ... and stained for 30 min on ice with surface antibodies at a 1:200 dilution in a 1:1 mixture of FACS buffer and Brilliant Stain Buffer (BD Biosciences). Cells were washed with FACS buffer and PBS and fixed with 2% paraformaldehyde on ice for 20 min ...
-
bioRxiv - Microbiology 2023Quote: ... 1 x 106 parasites were collected and incubated with VSG2WT antisera (1:4000) or VSG11WT (1:1000) together with Fc block (1:200, BD Pharmingen) in cold HMI-9 without FBS for 10 min at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... The cOBBs were resuspended in 1:1 v/v ECM gel to cOBBs and transferred to a 1 mL disposable syringe (BD Biosciences). The cOBBs were centrifuged at 100g for 3 min and the supernatant removed ...
-
bioRxiv - Cancer Biology 2024Quote: ... bilateral subcutaneous dorsal flank tumors were established by injecting 1 × 106 cells suspended in a 1:1 mixture of serum-free medium and Matrigel (BD Biosciences). Once tumors reached an average volume of 100 mm3 ...
-
bioRxiv - Bioengineering 2024Quote: ... Viability dye was quenched by washing with FACS buffer (PBS + 2% FBS + 1 mM EDTA) before addition of surface staining antibodies in a 1:1 dilution of Brilliant Stain Buffer (BD 563794) in FACS buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... and subsequentenly with primary antibodies (1/30 Ki-67 Cat. 550609 and 1/200 Anti BrdU Cat. 555627, both in 1% BSA, BD Pharmingen) overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... We used three different antibodies: anti-DRBP76 (anti-double stranded RNA binding protein 76 or anti-NF90) antibody (BD Biosciences), N-terminus anti-EBP1 (Abcam) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... cells were washed again and re-suspended in permeabilization buffer with the following fluorescently-tagged antibodies targeting intracellular T-lymphocyte proteins for 30 min: IL-4 BV 421 (BD Biosciences clone 11B11 ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Genomics 2020Quote: ... Primary antibodies (anti-Cas9 7A9-3A3, Cell Signaling Technology #14697S, anti-γ-tubulin Sigma#T5326, anti-Human Retinoblastoma protein BD Pharmigen #554136 ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...