Labshake search
Citations for Avidity :
1 - 50 of 128 citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... we biotinylated SARS-CoV-2 RBD using a terminal AviTag and BirA biotin ligase (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The avi-tagged SARS-CoV-2 RBD antigen was first labeled with biotin (Avidity, BirA500) was subsequently coupled to streptavidin-PE and streptavidin-APC (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... the probes were generated by the biotinylation of Avi-tagged SARS-CoV-2 antigens using biotin ligase BirA according to the manufacturer’s instructions (Avidity). Biotin excess was removed by SEC on either a Superdex 200 10/300 column (GE Healthcare ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 NTD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before (Robbiani et al. ...
-
bioRxiv - Immunology 2021Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before 1 ...
-
bioRxiv - Immunology 2020Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Avi-tagged SARS-CoV-2 RBD and SD1-RBD (both corresponding to SARS-CoV-2 ancestral virus) were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... S1 protein was biotinylated at the AVI-tag using the BirA biotin-protein ligase kit (Avidity Biosciences) and premixed at 5 nM with serial dilutions of VNAR-hFc antibodies for 1 hr at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... The captured SARS-CoV-2 protein was then biotinylated using the BIRA500 kit (∼2.5 μg per 10 nmol AVI substrate) (Avidity) and cleaved from the Fc purification tag concurrently with 200 μg of HRV3C prepared as described [42] ...
-
bioRxiv - Immunology 2020Quote: ... purified spike ectodomain trimers were biotinylated by addition of biotin-protein ligase (Avidity, Aurora, CO). Biotinylated spike ectodomain trimers were buffer exchanged into PBS ...
-
bioRxiv - Immunology 2024Quote: ... The purified spike protein was biotinylated using the BirA biotin-protein ligase reaction kit (Avidity) following the manufacturer’s recommendation ...
-
bioRxiv - Immunology 2023Quote: ... purified spike ectodomain trimers and RBD domain protein were biotinylated by the addition of biotin-protein ligase (Avidity). Biotinylated proteins were buffer exchanged into PBS ...
-
bioRxiv - Biophysics 2024Quote: ... and subsequently biotinylated at the C-termini Avi tag sequence via BirA biotin-protein ligase (Avidity) (31) ...
-
bioRxiv - Immunology 2020Quote: All antigens with an Avi tag were biotinylated enzymatically using BirA biotin-protein ligase (Avidity, Bulk BirA) while non-Avi tagged antigens were biotinylated chemically using EZ-Link Sulfo-NHS-Biotin (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... S proteins with Avi-tag were pre-biotinylated using BirA biotin-protein ligase standard reaction kit (Avidity). 25 nM S-614D or 15 nM S-614G in 10X kinetic buffer (ForteBio ...
-
bioRxiv - Neuroscience 2023Quote: The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
bioRxiv - Bioengineering 2019Quote: ... The recombinant extracellular domain of CD38 and PD-L1 was produced as a 6-His and AviTag™ fusion in HEK293 cells and purified by Ni-NTA followed by in vitro biotinylation by BirA biotin ligase (Avidity).
-
bioRxiv - Cell Biology 2022Quote: ... with N-terminal MRGS(H)8 and C-terminal Avi tag was biotinylated in vivo by co-expressing biotin-ligase BirA (pBirAcm from Avidity) in E.coli BL21 (DE3) ...
-
bioRxiv - Immunology 2023Quote: ... featuring an unpaired cysteine residue and C-terminally extended with an AVI-tag (GLNDIFEAQKIEWHE) for site-specific biotinylation with the BirA biotin ligase (Avidity) preceded by a 3C protease recognition site (LEVLFQGP ...
-
bioRxiv - Immunology 2023Quote: Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: Phage display vectors were converted into Fab expression vectors that contain a substrate tag for the biotin ligase BirA (AviTag, Avidity, LLC) at the carboxyl terminus of the heavy chain ...
-
bioRxiv - Biophysics 2022Quote: The GPIbα used for kinetic measurements contained an N-terminal Avi-tag which was biotinylated using a BirA biotin-protein ligase kit (Cat #BirA500, Avidity, Aurora, CO). Biolayer interferometry (BLI ...
-
bioRxiv - Immunology 2023Quote: ... 500μM biotin (Avidity) was then added at a 1:100 ratio relative to the total solution volume and incubated rotating for 10min at RT ...
-
bioRxiv - Immunology 2024Quote: ... Free biotin (Avidity, Cat. #BIO200) was added to the beads at 5 μM and incubated for 15 min at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... Free biotin (Avidity, Cat. #BIO200) was added to the beads at 5 μM and incubated for 15 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... I-Ek/ANP α-biotin was site-specifically biotinylated using the BirA biotin ligase (Avidity) and purified via Ni-NTA agarose (to remove BirA ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before18 ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 WT and Delta RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before(Robbiani et al. ...
-
bioRxiv - Biophysics 2019Quote: ... d-Biotin was purchased from Avidity, LLC (Aurora ...
-
bioRxiv - Cell Biology 2023Quote: ... and 50 μM d-biotin (Avidity) at 4°C overnight.
-
bioRxiv - Immunology 2021Quote: ... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
bioRxiv - Biophysics 2020Quote: ... Excess streptavidin was blocked with biotin (Avidity). Before SHP-1 injection ...
-
bioRxiv - Immunology 2023Quote: ... competing antibody was diluted to a final concentration of 5 µg/mL in blocking buffer and added to 2 µg/mL GP that was biotinylated through a fused Avi-tag (Avidity, Aurora, Colorado) and incubated for one hour at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Env trimers with C-terminal avi-tags (Avidity) were biotinylated and conjugated to streptavidin labeled with different fluorochormes ...
-
bioRxiv - Immunology 2021Quote: ... D-biotin (20 μM; Avidity; Cat no I2011) was added 24 h after multimerization ...
-
bioRxiv - Biophysics 2019Quote: ... Biotin ligase BirA (Avidity LLC, Aurora, CO, US) was used to biotinylate Avitag-kinesin (28).
-
bioRxiv - Immunology 2020Quote: ... containing 5μM free d-biotin (Avidity, Cat# Bir500A). Free d-biotin ensured minimal cross-reactivity of antigen probes ...
-
bioRxiv - Biophysics 2022Quote: ... Constructs were biotinylated using BirA Biotin Ligase (Avidity) following the manufactures suggested protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Purified SARS2 D614G spike protein was biotinylated using BirA500 biotinylation kit from Avidity. To 50 ug of spike protein ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two complimentary oligonucleotides corresponding to the Avi-tag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA incorporating Hindlll overlapping ends were synthesized (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2021Quote: ... Biotinylation was carried out with BirA biotin ligase (Avidity).
-
bioRxiv - Bioengineering 2022Quote: ... and 10 μL of 5 mM D-biotin (Avidity) were added to the protein along with BirA ligase ...
-
bioRxiv - Immunology 2021Quote: To investigate Fc receptor binding recombinant Fc receptors with an AviTag were biotinylated using a Bir500 kit (Avidity, Aurora, CO, USA) according to manufacturer’s instructions and purified using a Zeba Spin Desalting Column ...
-
bioRxiv - Immunology 2023Quote: ... GP was biotinylated by the Avi tag (Avidity, Aurora, Colorado) and exchanged into PBS 7.4.
-
bioRxiv - Bioengineering 2022Quote: ... Purified samples were biotinylated using BirA biotin ligase (Avidity Inc.) at 1 µg of BirA enzyme per 10 nM of protein.
-
bioRxiv - Immunology 2021Quote: ... AviTagged antigens were biotinylated using BirA biotin ligase (Avidity LLC).
-
bioRxiv - Immunology 2021Quote: ... Avitagged antigens were biotinylated using BirA biotin ligase (Avidity LLC).
-
bioRxiv - Immunology 2022Quote: ... complexes were biotinylated overnight at 4°C using biotin (Avidity), ATP ...
-
Mechanical forces impair antigen discrimination by reducing differences in T cell receptor off-ratesbioRxiv - Immunology 2022Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2020Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...