Labshake search
Citations for Avidity :
1 - 50 of 112 citations for Chromosome 11 Open Reading Frame 53 C11ORF53 Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2023Quote: ... 500μM biotin (Avidity) was then added at a 1:100 ratio relative to the total solution volume and incubated rotating for 10min at RT ...
-
bioRxiv - Immunology 2024Quote: ... Free biotin (Avidity, Cat. #BIO200) was added to the beads at 5 μM and incubated for 15 min at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... Free biotin (Avidity, Cat. #BIO200) was added to the beads at 5 μM and incubated for 15 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... I-Ek/ANP α-biotin was site-specifically biotinylated using the BirA biotin ligase (Avidity) and purified via Ni-NTA agarose (to remove BirA ...
-
bioRxiv - Biophysics 2019Quote: ... d-Biotin was purchased from Avidity, LLC (Aurora ...
-
bioRxiv - Cell Biology 2023Quote: ... and 50 μM d-biotin (Avidity) at 4°C overnight.
-
bioRxiv - Biophysics 2020Quote: ... Excess streptavidin was blocked with biotin (Avidity). Before SHP-1 injection ...
-
bioRxiv - Immunology 2021Quote: ... D-biotin (20 μM; Avidity; Cat no I2011) was added 24 h after multimerization ...
-
bioRxiv - Biophysics 2019Quote: ... Biotin ligase BirA (Avidity LLC, Aurora, CO, US) was used to biotinylate Avitag-kinesin (28).
-
bioRxiv - Immunology 2020Quote: ... containing 5μM free d-biotin (Avidity, Cat# Bir500A). Free d-biotin ensured minimal cross-reactivity of antigen probes ...
-
bioRxiv - Biophysics 2022Quote: ... Constructs were biotinylated using BirA Biotin Ligase (Avidity) following the manufactures suggested protocol ...
-
bioRxiv - Immunology 2021Quote: ... Biotinylation was carried out with BirA biotin ligase (Avidity).
-
bioRxiv - Bioengineering 2022Quote: ... and 10 μL of 5 mM D-biotin (Avidity) were added to the protein along with BirA ligase ...
-
bioRxiv - Bioengineering 2022Quote: ... Purified samples were biotinylated using BirA biotin ligase (Avidity Inc.) at 1 µg of BirA enzyme per 10 nM of protein.
-
bioRxiv - Immunology 2021Quote: ... AviTagged antigens were biotinylated using BirA biotin ligase (Avidity LLC).
-
bioRxiv - Immunology 2021Quote: ... Avitagged antigens were biotinylated using BirA biotin ligase (Avidity LLC).
-
bioRxiv - Immunology 2022Quote: ... complexes were biotinylated overnight at 4°C using biotin (Avidity), ATP ...
-
Mechanical forces impair antigen discrimination by reducing differences in T cell receptor off-ratesbioRxiv - Immunology 2022Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2020Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2020Quote: ... Avitagged antigens were biotinylated using BirA biotin ligase (Avidity LLC).
-
bioRxiv - Immunology 2022Quote: ... The purified proteins were biotinylated using biotin protein ligase (Avidity); excess biotin and ligase were removed with a Superdex 200 column (GE Healthcare) ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation was performed using a BirA biotin-protein ligation kit (Avidity) on proteins produced with a C-terminal avidin tag sequence ...
-
bioRxiv - Microbiology 2020Quote: ... a BirA biotin-protein ligase kit (Avidity, LLC; Aurora, CO, USA) was used to biotinylate protein samples ...
-
bioRxiv - Biophysics 2022Quote: ... the nanodiscs were labeled with biotin using the BirA Enzyme (Avidity) following the protocol provided by the manufacture ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA trimers were biotinylated by addition of biotin–protein ligase (Avidity). To generate HA tetramers ...
-
bioRxiv - Biophysics 2022Quote: ... coli.19 The purified proteins were biotinylated using biotin protein ligase (Avidity); excess biotin and ligase were removed with a Superdex 200 column (GE Healthcare).
-
bioRxiv - Immunology 2021Quote: ... for 10 min and excess streptavidin was quenched with 20 μM biotin (Avidity) for another 10 min ...
-
bioRxiv - Immunology 2022Quote: ... MHC multimers were diluted in PBS with 5.2 μM d-biotin (Avidity, Bio200) to 909 nM and incubated 20 min on ice ...
-
bioRxiv - Immunology 2023Quote: ... we extended the 14.4.4 scFV C-terminally with the BirA biotin ligase (Avidity) recognition site (GLNDIFEAQKIEWHE ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of monomer was carried out using BirA biotin-protein ligase kit (Avidity) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Overnight biotinylation reactions were performed using the BirA Biotin-Protein Ligase Kit (Avidity) at 4℃ in 1x BiomixA ...
-
bioRxiv - Biochemistry 2024Quote: ... The HKU1 RBDs were biotinylated using the BirA biotin ligase reaction kit (Avidity) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Tetramers with an AviTag were biotinylated with the BirA biotin-ligase kit (Avidity) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... the purified RBDs were biotinylated using the BirA biotin-protein ligase reaction kit (Avidity). The biotinylated proteins were re-purified and concentrated as described above ...
-
bioRxiv - Genetics 2021Quote: ... Excess streptavidin was blocked with two 40 s injections of 250 μM biotin (Avidity).
-
Mechanical forces impair antigen discrimination by reducing differences in T cell receptor off-ratesbioRxiv - Immunology 2022Quote: ... Excess streptavidin was blocked with two 40 s injections of 500 µM biotin (Avidity) and the sensor was conditioned with at least 8 injections of running buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... the proteins were biotinylated using the BirA biotin-protein ligase reaction kit (Avidity, #BirA500). Biotinylation of the NiV protein probes was confirmed by biolayer interferometry by testing the ability of the biotinylated protein to bind to streptavidin sensors ...
-
Mechanical forces impair antigen discrimination by reducing differences in T cell receptor off-ratesbioRxiv - Immunology 2022Quote: ... Excess streptavidin was blocked with two 40 s injections of 250 µM biotin (Avidity). Before injections of soluble 1G4 or A6 αβTCR (51 kDa) ...
-
bioRxiv - Immunology 2021Quote: ... Excess streptavidin was blocked with two 40 s injections of 250 µM biotin (Avidity). Before injections of soluble 1G4 or A6 αβTCR (51 kDa) ...
-
bioRxiv - Immunology 2020Quote: ... Excess streptavidin was blocked with two 40 s injections of 250 μM biotin (Avidity). Before TCR injections ...
-
bioRxiv - Microbiology 2021Quote: ... Excess streptavidin was blocked with two 40 s injections of 250 μM biotin (Avidity). Before RBD injections ...
-
bioRxiv - Immunology 2020Quote: ... purified PR8-HA and S proteins were biotinylated using BirA biotin-protein ligase (Avidity). Biotinylated PR8-HA and S proteins were fluorescently labelled by the sequential addition of streptavidin-conjugated to phycoerythrin (PE ...
-
bioRxiv - Immunology 2021Quote: ... each FcγR was biotinylated using a BirA biotin-protein ligase bulk reaction kit (Avidity) according to the protocol of the manufacturer ...
-
bioRxiv - Immunology 2023Quote: BSP-tagged proteins were biotinylated using the BirA biotin-ligase bulk reaction kit (Avidity), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Excess streptavidin was blocked with two 40 s injections of 250 μM biotin (Avidity). Before antibody injections ...
-
bioRxiv - Immunology 2024Quote: ... biotinylation with BirA biotin-protein ligase standard reaction kit (Avidity, 318 LLC-Aurora, Colorado), and purification using size-exclusion column (Waters ...
-
bioRxiv - Immunology 2024Quote: ... HLA-DR monomers were biotinylated overnight at 4°C using BirA biotin ligase (Avidity) and purified by size exclusion chromatography using Superdex 200 size exclusion column (AKTA ...
-
bioRxiv - Biophysics 2021Quote: ... coli BL21(DE3) cells harboring pBirAcm encoding the biotin ligase (Avidity, LCC, Aurora, Colorado, USA). For over-expression cells over-night cultures were diluted 1:100 in fresh LB medium supplemented with 20 mg/l Biotin ...