Labshake search
Citations for Avidity :
1 - 50 of 94 citations for Borrelia Miyamotoi GlpQ Protein His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... S proteins with Avi-tag were pre-biotinylated using BirA biotin-protein ligase standard reaction kit (Avidity). 25 nM S-614D or 15 nM S-614G in 10X kinetic buffer (ForteBio ...
-
bioRxiv - Bioengineering 2021Quote: ... S1 protein was biotinylated at the AVI-tag using the BirA biotin-protein ligase kit (Avidity Biosciences) and premixed at 5 nM with serial dilutions of VNAR-hFc antibodies for 1 hr at 4°C ...
-
bioRxiv - Biophysics 2024Quote: ... and subsequently biotinylated at the C-termini Avi tag sequence via BirA biotin-protein ligase (Avidity) (31) ...
-
bioRxiv - Immunology 2020Quote: All antigens with an Avi tag were biotinylated enzymatically using BirA biotin-protein ligase (Avidity, Bulk BirA) while non-Avi tagged antigens were biotinylated chemically using EZ-Link Sulfo-NHS-Biotin (Thermo Fisher ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified proteins with an avi-tag were biotinylated by using BirA following the BirA500 kit’s protocol (Avidity, BirA500). Biotinylation was confirmed by performing a Coomassie gel shift assay according to Fairhead and Howarth ...
-
bioRxiv - Immunology 2023Quote: Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
bioRxiv - Biophysics 2022Quote: The GPIbα used for kinetic measurements contained an N-terminal Avi-tag which was biotinylated using a BirA biotin-protein ligase kit (Cat #BirA500, Avidity, Aurora, CO). Biolayer interferometry (BLI ...
-
bioRxiv - Immunology 2023Quote: ... Env trimers with C-terminal avi-tags (Avidity) were biotinylated and conjugated to streptavidin labeled with different fluorochormes ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two complimentary oligonucleotides corresponding to the Avi-tag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA incorporating Hindlll overlapping ends were synthesized (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2023Quote: ... GP was biotinylated by the Avi tag (Avidity, Aurora, Colorado) and exchanged into PBS 7.4.
-
bioRxiv - Immunology 2020Quote: ... were captured using mouse anti-AVI-tag mAb (Avidity LLC, Aurora, CO). In brief ...
-
bioRxiv - Microbiology 2020Quote: ... The RBD with a BirA tag was biotinylated using a biotinylation kit (Avidity, LLC) and was immobilized through the Biotin CAPture Reagent ...
-
bioRxiv - Biophysics 2023Quote: ... For in in vivo biotinylation on the Avi-tag the plasmid pBirA (Avidity Nanomedicines, La Jolla, CA) was cotransformed and the cell culture procedure was adapted according to Avidity’s in vivo biotinylation protocol.
-
bioRxiv - Neuroscience 2023Quote: The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
bioRxiv - Biophysics 2019Quote: ... was C-terminally equipped with an AVI-tag (GLNDIFEAQKIEWHE) for site-specific biotinylation via the BirA ligase (Avidity) followed by a 3C protease cleavable (LEVLFQGP ...
-
bioRxiv - Immunology 2022Quote: ... The purified proteins were biotinylated using biotin protein ligase (Avidity); excess biotin and ligase were removed with a Superdex 200 column (GE Healthcare) ...
-
bioRxiv - Immunology 2021Quote: ... trimers used as baits in flow cytometry were expressed with a C-term Avi-tag and biotinylated using a BirA biotinylation kit according to manufacturer’s instructions (Avidity). The BG505 MD39-base KO trimer had the following mutations relative to the BG505 MD39 SOSIP ...
-
bioRxiv - Biophysics 2022Quote: ... coli.19 The purified proteins were biotinylated using biotin protein ligase (Avidity); excess biotin and ligase were removed with a Superdex 200 column (GE Healthcare).
-
bioRxiv - Cell Biology 2022Quote: ... with N-terminal MRGS(H)8 and C-terminal Avi tag was biotinylated in vivo by co-expressing biotin-ligase BirA (pBirAcm from Avidity) in E.coli BL21 (DE3) ...
-
bioRxiv - Immunology 2023Quote: ... featuring an unpaired cysteine residue and C-terminally extended with an AVI-tag (GLNDIFEAQKIEWHE) for site-specific biotinylation with the BirA biotin ligase (Avidity) preceded by a 3C protease recognition site (LEVLFQGP ...
-
bioRxiv - Cancer Biology 2020Quote: Phage display vectors were converted into Fab expression vectors that contain a substrate tag for the biotin ligase BirA (AviTag, Avidity, LLC) at the carboxyl terminus of the heavy chain ...
-
bioRxiv - Immunology 2021Quote: Constructs containing an Avi-tag (ZM197 Env and HA NC99) were biotinylated using the site-specific biotinylation kit according to manufacturer instructions (Avidity LLC.) All other antigens not containing an Avi-tag were non-specifically biotinylated using the EZ-Link Sulfo-NHS-Biotin kit at a 50:1 biotin:protein molar ratio.
-
bioRxiv - Synthetic Biology 2023Quote: Proteins with Avi-tags (GLNDIFEAQKIEWHE; see supplementary materials) were purified as described above and biotinylated in vitro using the BirA500 (Avidity, LLC) biotinylation kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... the proteins were biotinylated using the BirA biotin-protein ligase reaction kit (Avidity, #BirA500). Biotinylation of the NiV protein probes was confirmed by biolayer interferometry by testing the ability of the biotinylated protein to bind to streptavidin sensors ...
-
bioRxiv - Immunology 2020Quote: ... purified PR8-HA and S proteins were biotinylated using BirA biotin-protein ligase (Avidity). Biotinylated PR8-HA and S proteins were fluorescently labelled by the sequential addition of streptavidin-conjugated to phycoerythrin (PE ...
-
bioRxiv - Immunology 2023Quote: ... competing antibody was diluted to a final concentration of 5 µg/mL in blocking buffer and added to 2 µg/mL GP that was biotinylated through a fused Avi-tag (Avidity, Aurora, Colorado) and incubated for one hour at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... The purified spike protein was biotinylated using the BirA biotin-protein ligase reaction kit (Avidity) following the manufacturer’s recommendation ...
-
bioRxiv - Immunology 2020Quote: ... The RBD protein was biotinylated with the BirA biotin-protein ligase kit (Avidity LLC, Colorado, USA) using the manufacturer’s protocol.
-
bioRxiv - Immunology 2020Quote: ... BirA biotinylation of S proteins was conducted using BirA biotin-protein ligase bulk reaction kit (Avidity). Coronavirus S proteins with Avi-tags were concentrated to 7-9 mg/ml using 100K Amicon tubes in TBS ...
-
bioRxiv - Molecular Biology 2021Quote: Biotinylation of SNAP tagged proteins and Avi-tagged proteins were performed as suggested by manufactures (NEB, Avidity). Direct biotinylation of proteins for example-YenB ...
-
bioRxiv - Immunology 2022Quote: ... AviTagged tri-S and RBD proteins were biotinylated using BirA biotin-protein ligase bulk reaction kit (Avidity, LLC) or Enzymatic Protein Biotinylation Kit (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... purified spike ectodomain trimers and RBD domain protein were biotinylated by the addition of biotin-protein ligase (Avidity). Biotinylated proteins were buffer exchanged into PBS ...
-
bioRxiv - Immunology 2020Quote: ... purified S1B/RBD or S proteins were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Biotinylated-CoV proteins were captured on streptavidin coated 96-well plates (Thermo Scientific ...
-
bioRxiv - Immunology 2023Quote: ... rhesus macaque FcγR2A and FcγR3A (acquired from the Duke Human Vaccine Institute Protein Production Facility) were biotinylated with a BirA biotin–protein ligase bulk reaction kit (Avidity). C1Q (Sigma ...
-
bioRxiv - Immunology 2022Quote: Aliquots of RBD-HISAVI protein were biotinylated in vitro using the BirA500:BirA biotin-protein ligase standard reaction kit (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: S protein was biotinylated using Bir-A (Avidity) and labelled by the sequential addition of streptavidin (SA ...
-
bioRxiv - Biophysics 2022Quote: ... with biotinylated/unbiotinulated MBP-AviTagTM fusion protein (Avidity) as controls.
-
bioRxiv - Immunology 2021Quote: ... and HA proteins were biotinylated using AviTag technology (Avidity) according to published protocols (51 ...
-
bioRxiv - Immunology 2024Quote: ... Protein was biotinylated using the BirA enzyme (Avidity, USA) and purified via size-exclusion chromatography (Superdex S75 column ...
-
Mechanical forces impair antigen discrimination by reducing differences in T cell receptor off-ratesbioRxiv - Immunology 2022Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2020Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.325 μg/μl Maltose Binding Protein (MBP)-AviTag substrate (Avidity, L.L.C.), 8.3 mM ATP and 42 μM biotin ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation was performed using a BirA biotin-protein ligation kit (Avidity) on proteins produced with a C-terminal avidin tag sequence ...
-
bioRxiv - Immunology 2020Quote: ... The Avi-tagged proteins were biotinylated using the BirA enzyme (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... a BirA biotin-protein ligase kit (Avidity, LLC; Aurora, CO, USA) was used to biotinylate protein samples ...
-
bioRxiv - Immunology 2023Quote: ... The Avi-tagged proteins were biotinylated using the BirA enzyme (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA trimers were biotinylated by addition of biotin–protein ligase (Avidity). To generate HA tetramers ...
-
bioRxiv - Immunology 2022Quote: ... purified fractions were biotinylated using a BirA protein ligase kit (Avidity LLC). The biotinylated proteins were further purified by gel filtration (S200 ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were biotinylated with 5 μg of BirA protein ligase (Avidity) per mg of protein for 1 hr at room temperature ...