Labshake search
Citations for Lucigen :
1 - 50 of 60 citations for Streptococcus Pneumoniae Antigen Native Extract since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... pneumoniae ECL8 electrocompetent cells were transformed with 0.2 µL of EZ-Tn5™ transposon (Epicentre) at 1.4 kV and recovered in brain heart infusion (BHI ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and genomic DNA was extracted using 50 μL of Quick Extract DNA Extract Solution (Lucigen, QE09050) per well according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... 50 µL of Quick Extract (Lucigen) was added to the cell pellet and the cell mixture was transferred to a 96-well PCR plate (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: Quick extract DNA extraction solution (Lucigen) was tested in accordance with the manufacturer’s suggested buffer to sample ratio ...
-
bioRxiv - Genetics 2024Quote: ... DNA Quick Extract (Lucigen # 76081-766) was used to isolate DNA ...
-
bioRxiv - Synthetic Biology 2020Quote: ... followed by resuspension in Quick Extract (Lucigen). Samples were vortexed at top speed for 15 seconds ...
-
bioRxiv - Genetics 2022Quote: ... 20uL of Quick Extract buffer (Lucigen QE0905T) was added ...
-
bioRxiv - Genetics 2023Quote: ... Cells were harvested using Quick Extract (Lucigen) per the manufacturer’s instructions beginning at 2 days after transfection until 6 days after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by chromosomal DNA isolation (Quick Extract /Lucigen), PCR amplification (Sup Table 8 ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were harvested using Quick Extract solution (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested using Quick Extract solution (Lucigen). Amplicons were generated with Phusion Flash High-Fidelity 2x Mastermix (F548 ...
-
bioRxiv - Genetics 2020Quote: DNA was isolated using QuickExtract DNA extract solution (Lucigen) for PCR grade DNA or the QIAamp DNA mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: 30 µl of Quick Extract DNA Estraction (Lucigen, QE09050,) was added to 5.0 x 104 pelleted iPSC ...
-
bioRxiv - Genetics 2023Quote: ... The cell pellet was resuspended in Quick-Extract (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA was isolated (Quick Extract DNA extraction solution, Lucigen), amplified by PCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... whereas organoid samples were directly added to Quick Extract (Lucigen), and vortexed ...
-
bioRxiv - Bioengineering 2019Quote: ... genomic DNA was extracted from cells using Quick Extract (Lucigen, QE09050) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Developmental Biology 2020Quote: ... 100,000 iPSCs were taken for DNA extraction using Quick Extract (Lucigen), whereas organoid samples were directly added to Quick Extract (Lucigen) ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were incubated for 72h and harvested with Quick Extract (Lucigen). Genomic DNA was amplified using genomic region-specific primers (Supplemental) ...
-
bioRxiv - Genetics 2023Quote: ... Cell pellets were resuspended in 50 µL of Quick Extract (Lucigen), and genomic DNA was prepared per the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: ... Samples were incubated for 72h and harvested with Quick Extract (Lucigen). Genomic DNA was amplified and sequenced as described above.
-
bioRxiv - Genomics 2020Quote: ... washed with PBS and resuspended in 200 μL of Quick Extract (Lucigen) lysis buffer and cells were lysed according to the manufacture’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... approximately 30,000 cells were lysed in 25ul Quick Extract Buffer (Lucigen #QE09050), according to the manufacturer’s directions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and genomic DNA was isolated using a Quick-Extract Buffer (Lucigen GE09050). Successful heterozygous deletion lines were identified using the PCR primers CCCCCACCCATCAGTCATTC and GGTTGTGCCTCATAGTGCCT and Q5 Polymerase (NEB M0491S) ...
-
bioRxiv - Bioengineering 2024Quote: ... with final resuspension into 30 µl of Quick Extract™ reagent (Lucigen). For mutagenesis analysis ...
-
bioRxiv - Cancer Biology 2021Quote: DNA was extracted from cells using Quick Extract (Lucigen, Wisconsin, USA, Cat #QE09050) and amplified using primer pairs listed in Table S4 designed to amplify 66-80 base pair segments containing the predicted cut site for each of our gRNAs listed in Table of gRNAs ...
-
bioRxiv - Biophysics 2022Quote: ... The product was then packaged into phage particles using phage extract (MaxPlax, Epicentre). Plaques were generated on LE392 E ...
-
bioRxiv - Genomics 2021Quote: ... and then were resuspended in 385 µL DNA Quick Extract (Lucigen cat# QE09050) and transferred to a 1.5 mL tube ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from the cells using QuickExtract DNA Extract Solution (Lucigen, QE9050). Clones were genotyped by PCR and Sanger Sequencing (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2023Quote: ... The products were then packaged into phage particles using phage extract (MaxPlax, Epicentre) and amplified by lytic growth in LE392 cells (NEB) ...
-
bioRxiv - Immunology 2024Quote: ... CD4+ T cells were collected and gDNA was isolated with Quick Extract (Lucigen) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell lysates were prepared using the EasyLyseTM bacterial protein extract solution (Lucigen Corp. USA) or the CelLytic B reagent (Sigma ...
-
bioRxiv - Genomics 2019Quote: ... DNA from surviving clones (194/1200) was isolated using DNA quick extract solution (Lucigen) following a modified protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell lysates were prepared using the EasyLyseTM bacterial protein extract solution (Lucigen Corp. USA) or the CelLytic B reagent (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Cosmid libraries were constructed using MaxPlax™ Lambda Packaging Extracts (Lucigen Corp, Middleton, WI).
-
bioRxiv - Microbiology 2021Quote: ... To extract DNA 10 ul of culture was added to 500 ul QuickExtract Solution (Epicentre) and treated 65 °C for 6 min followed by 98 °C for 2 min ...
-
bioRxiv - Microbiology 2022Quote: ... After the in vitro packaging into the phage lambda (MaxPlax™ Lambda Packaging Extract, Epicentre), the transfected phage T1-resistant EPI300™-T1R E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Genomic DNA from 5,000 - 50,000 CAR-expressing T cells was extracted using Quick Extract (Lucigen) and used as the template for a 2-step PCR strategy ...
-
bioRxiv - Genetics 2021Quote: ... The mycobacteriophage used for knockout was obtained using MaxPlax packaging extract (Epicentre Biotechnologies, Madision, WI, USA) and a katG knockout strain was obtained by phage transduction ...
-
bioRxiv - Genetics 2020Quote: For single cell clones or bulk sequencing genomic DNA (gDNA) was extracted by quick extract (Lucigen). PCR amplification was performed with LongAmp Polymerase (NEB ...
-
bioRxiv - Immunology 2022Quote: ... DNA extract was prepared from an aliquot of cells with QuickExtract DNA Extraction Solution (Lucigen Corporation). Only wells containing single clones were screened using PCR primers flanking the Cas9 cut sites and by Sanger sequencing (Genewiz ...
-
bioRxiv - Genetics 2024Quote: Genomic DNA from ear punches was isolated using Quick Extract DNA Extraction Solution (Lucigen., Cat# QE09050). All genotyping PCRs were carried out using MyTaq™ Red Mix (Bioline ...
-
bioRxiv - Genetics 2021Quote: ... genomic DNA from bulk cells of each transfected well was extracted using Quick Extract buffer (Lucigen #QE0905T). following the protocol published by the manufacturer (https://www.lucigen.com/docs/manuals/MA150E-QuickExtract-DNA-Solution.pdf) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The ligated DNA was packaged into virions using the MaxPlax λ packaging extract (Lucigen #MP5120, Middleton, WI, USA), and the virions were sequenced to determine input barcode frequency.
-
bioRxiv - Cancer Biology 2021Quote: ... These primers were used to amplify cell pools after DNA extraction using Quick Extract (Lucigen, Wisconsin, USA, Cat #QE09050). Amplified reads were sequenced on either an Illumina MiSeq or Illumina HiSeq 2500.
-
bioRxiv - Cancer Biology 2024Quote: ... To obtain ribosome footprints 0.12 ml of total extracts containing 300 µg of total RNA were treated with RNAse I (Epicentre) (25U/1 mg of total RNA) ...
-
bioRxiv - Immunology 2019Quote: ... washed once in PBS and genomic DNA was recovered from 1 x 106 cells using 100 μl Quick Extract solution (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... DNA was isolated from tail snips of MyD88 CRISPy TAKO and Mock-treated control offspring using Quick Extract (Lucigen, #QE09050). Primers for MyD88 genotyping are listed in Table 1 ...