Labshake search
Citations for Lucigen :
1 - 50 of 354 citations for SARS CoV 2 Spike E M Mosaic Protein His tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (E cloni, Lucigen) for secondary screening ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G); post-heat shock recovery time was limited to 15-20 minutes to avoid cell division during recovery and ensure that each resulting colony was the result of an independent transformation event ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G). Around 800 thousand colonies were recovered ...
-
bioRxiv - Biochemistry 2022Quote: ... coli cells (E. cloni 10G Elite, Lucigen, USA). Further details on the microfluidic screening can be found in the Supplementary Information.
-
bioRxiv - Immunology 2021Quote: Full-length SARS-CoV-2 and HCoV-OC43 nucleoproteins were produced by expression in Escherichia coli C43(DE3) cells (Lucigen) and purified as previously described (12) ...
-
bioRxiv - Biochemistry 2023Quote: The NDM libraries are then transformed into Escherichia coli (E. cloni 10G, Lucigen) and stored as glycerol stocks ...
-
bioRxiv - Biochemistry 2023Quote: ... the library was electroporated into Escherichia coli cells (E. cloni 10G Elite; Lucigen, USA), yielding ≈ 107 colonies after overnight incubation on agar plates ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... and primers outlined in Table S1. E. coli colony PCRs (Fig. 1F and Fig. S1F- H) were performed with CloneID 1X Colony PCR Mix (Lucigen 30059-2) and primers outlined in Table S1.
-
bioRxiv - Evolutionary Biology 2019Quote: ... 7.5 µL Failsafe Premix E (Epicentre), 1.2 µL each of F and R primers (IDT) ...
-
bioRxiv - Microbiology 2022Quote: ... Escherichia coli BL21(DE3) Hi-Control (Lucigen) was used as an expression host for heterologous expression of HpuA ...
-
bioRxiv - Cell Biology 2021Quote: ... cloni 5-alpha (short: E. cloni, Lucigen corporation) for all cloning procedures ...
-
bioRxiv - Genomics 2020Quote: ... using a Gibson assembly master mix (New England Biolabs).Gibson assembly products were transformed into electrocompetent cells (E. cloni, Lucigen) and plated on 245mm x 245mm square LB-agar plates to obtain the sufficient number of bacterial colonies at a ∼50× library coverage ...
-
bioRxiv - Genetics 2021Quote: ... coli (Lucigen, 60242-2) by electroporation (1.8 kV ...
-
bioRxiv - Neuroscience 2022Quote: ... coli (Lucigen 60242-2) using program EC1 on MicroPulser Electroporator (Bio-Rad 1652100 ...
-
bioRxiv - Cancer Biology 2019Quote: ... coli (Lucigen, cat. 60242-2) using Bio-Rad MicroPulser Electroporator (cat ...
-
bioRxiv - Immunology 2020Quote: ... coli (Lucigen, Cat# 60502-2) over fifty shocks for each library ...
-
bioRxiv - Genetics 2022Quote: ... single BFU-E and CFU-GM were lysed with QuickExtract Lysis Buffer (Epicentre). CFCs were incubated at 65°C for 20 min followed by an incubation at 98°C for 10 min and centrifuged at 13000 rpm for 10 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... coli cells (Lucigen, catalog no. 60242-2) at 50–100 ng/ul ...
-
bioRxiv - Microbiology 2021Quote: ... The reconstructed product OmRV-fragment1/pACYC177 was then transformed into 10G chemically competent cells (Lucigen, E. cloni), propagated for plasmid purification with the aforementioned method ...
-
bioRxiv - Microbiology 2019Quote: ... Protein purification was accomplished using the pETite N-His vector (Lucigen). PCR primers were designed to amplify products for BT2807 and BT2808 containing all amino acids downstream of the predicted signal peptide sequences ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Biochemistry 2023Quote: ... coli (C41) cells for protein expression were purchased from Lucigen Corporation (Wisconsin) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10G electrocompetent cells (60080-2, Lucigen, Middleton, WI, US). Cells were selected with appropriate antibiotics on solid and liquid culture ...
-
bioRxiv - Microbiology 2021Quote: ... OmRV-fragment2/pMA (ampicillin resistant) and pACYC177 low-copy-number plasmids were transformed into 10G chemically competent cells (Lucigen, E. cloni), respectively ...
-
bioRxiv - Microbiology 2022Quote: ... coli (Lucigen). Transformations were immediately recovered in SOC medium at 30°C for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... coli (Epicentre), while sMVA F1 was cloned and maintained in DH10B E ...
-
bioRxiv - Cell Biology 2019Quote: ... coli (Lucigen) and induced at 37°C for 4h in 1mM IPTG (Thermo R0392) ...
-
bioRxiv - Genomics 2020Quote: ... coli (Lucigen) and 12μl ligation product ...
-
bioRxiv - Biochemistry 2020Quote: ... coli (Lucigen) in 1.0-mm Biorad cuvettes using a Gene Pulser Xcell Electroporation System (settings ...
-
bioRxiv - Microbiology 2021Quote: ... coli (Lucigen) through electroporation (2.5 kV ...
-
bioRxiv - Microbiology 2020Quote: ... coli (Lucigen). Aliquots of cells were spread onto 2YT agar plates supplemented with ampicillin and glucose ...
-
bioRxiv - Microbiology 2020Quote: ... coli (Lucigen), SHuffle T7 E ...
-
bioRxiv - Microbiology 2020Quote: ... coli (Lucigen), TG1 E ...
-
bioRxiv - Genetics 2020Quote: ... coli (Lucigen). A small aliquot of the transformant culture was plated to monitor library complexity ...
-
bioRxiv - Biochemistry 2022Quote: ... coli (Lucigen). Cells were recovered for 1 hour and plated on LB media containing ampicillin ...
-
bioRxiv - Biophysics 2022Quote: ... coli (Lucigen) with Terrific Broth (Sigma ...
-
bioRxiv - Biophysics 2023Quote: ... coli (Lucigen). Cultures were grown in 2xYT medium supplemented with 50 μg/ml kanamycin at 37°C until an OD600 of ∼1.5 was reached ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli (Lucigen), and harvested the plasmid DNA using the Qiaprep Spin miniprep kit (Qiagen) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (Lucigen).
-
bioRxiv - Microbiology 2023Quote: ... coli (Lucigen) and induced according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli (Lucigen) and grown overnight in 500 ml LB media for 16 h at 32°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The library was transformed into electrocompetent Lucigen Endura™ Escherichia coli (Lucigen; cat. 60242-2) using a Bio-Rad MicroPulser Electroporator (#1652100) ...
-
bioRxiv - Biochemistry 2022Quote: ... coli cells (Lucigen) and purified as described by Urbanek et al ...
-
bioRxiv - Biochemistry 2019Quote: ... coli cells (Lucigen) by electroporation ...
-
bioRxiv - Biochemistry 2019Quote: ... coli cells (Lucigen) were transformed by electroporation ...
-
bioRxiv - Biochemistry 2019Quote: ... coli cells (Lucigen) were transformed with the resulting plasmid by electroporation ...
-
bioRxiv - Biochemistry 2019Quote: ... coli cells (Lucigen) by electroporation ...
-
bioRxiv - Biochemistry 2019Quote: ... coli cells (Lucigen) by electroporation ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells (Lucigen). Cells cultured in SOC media and recovered for 45 minutes at 37 °C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen) and then cultivated at 37°C in LB medium supplemented with kanamycin and streptomycin ...