Labshake search
Citations for Lucigen :
1 - 50 of 192 citations for Recombinant Human Ribulose 5 Phosphate 3 Epimerase His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Terminator 5’-Phosphate Dependent Exonuclease (Lucigen) (1 U per 5 μg of RNA ...
-
bioRxiv - Molecular Biology 2023Quote: Terminator™ 5′-Phosphate-Dependent Exonuclease (Lucigen) was used to enrich the 5′ ends of the transcripts ...
-
bioRxiv - Molecular Biology 2021Quote: ... and T erminator 5’-Phosphate Dependent Exonuclease (Lucigen) (1 U per 5 μg of RNA ...
-
bioRxiv - Biochemistry 2024Quote: ... and TetraCys-tagged LexAPaCTD were amplified from the genomic DNA using primers LexA_Pa.For/Rev and LexA_Pa_CTD_4Cys.For/Rev (Supplementary Table 3) and cloned in pETite C-His Kan vector and pETite N-His SUMO Kan Vector (Lucigen), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... The ssDNA linker containing a 5′ phosphate and 3′ C3 spacer was ligated to the synthesized cDNA using 20 U of the Circligase I (Lucigen, Middleton, WI). The resultant cDNA was amplified by an adapter-based PCR using the KAPA HiFi DNA polymerase (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... samples were treated with Terminator 5′ phosphate-dependent exonuclease (Epicentre) to remove RNAs with 5′ monophosphate (5′ P ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were sequentially treated with Terminator 5‘-Phosphate-Dependent Exonuclease (Lucigen), Quick CIP (calf-intestine alkaline phosphatase ...
-
bioRxiv - Genomics 2023Quote: ... We added Terminator™ 5-Phosphate-Dependent Exonuclease (Lucigen, Wisconsin, USA) into one part for the +TEX sample following the user’s manual and skipped this step for the other half for -TEX sample ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by incubation with Terminator 5′-Phosphate-Dependent Exonuclease (TEX) (Lucigen) to remove all residual RNAs containing 5’ monophosphate ...
-
bioRxiv - Genomics 2020Quote: To test the Terminator™ 5’-phosphate-dependent exonuclease (Lucigen, Cat. # TER5120), 100 ng of total RNA in 2 μL was combined with 18 μL TEX mix ...
-
bioRxiv - Genomics 2021Quote: Monophosphorylated RNAs were selectively degraded by Terminator 5’-phosphate-dependent exonuclease (Lucigen). Subsequent 5’ dephosphorylation by CIP (NEB ...
-
bioRxiv - Neuroscience 2022Quote: Monophosphorylated RNAs were selectively degraded by Terminator 5’-phosphate-dependent exonuclease (Lucigen). Subsequent 5’ dephosphorylation by quickCIP (NEB ...
-
bioRxiv - Immunology 2021Quote: ... Monophosphorylated RNAs were selectively degraded by Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen) and RNAs were 5’dephosporylation by quickCIP (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... Prior to incubation with Terminator™ 5′-Phosphate-Dependent Exonuclease (TEX) (Lucigen) to remove all residual RNAs containing 5’ monophosphate ...
-
bioRxiv - Microbiology 2023Quote: ... Successful RppH treatment was verified by incubating 100 ng of 5’P or 5’PPP transcripts with 20 U RiboLock and 1 U Terminator™ 5’Phosphate-Dependent Exonuclease (Lucigen) in 1x TEX Buffer B for 30 min at 42°C ...
-
bioRxiv - Molecular Biology 2023Quote: Digestion of cellular RNA preperations with Terminator™5’Phosphate-Dependent Exonuclease (Epicentre) was perforemd to remove the abundant rRNA ...
-
bioRxiv - Biochemistry 2023Quote: ... The purified total mRNA was treated by 5’-Phosphate-Dependent Exonuclease (Lucigen, TER51020) to degrade RNAs with 5’ monophosphates ...
-
bioRxiv - Genomics 2019Quote: ... and ribosomal RNA was depleted by a Terminator-5--Phosphate-Dependent Exonuclease treatment (Epicentre). Ten RNA-Seq libraries were prepared from the enriched RNA samples using the ScriptSeq strand-specific protocol (Epicentre) ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Genomics 2024Quote: ... the DNA & rRNA depleted RNA samples were treated with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). After a one-hour incubation ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Genomics 2023Quote: ... Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). Subsequently ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs) was achieved by incubation of the RNA with the Terminator 5’-Phosphate-Dependent Exonuclease (TEX, Lucigen). For this purpose ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from the purified nsRNA fraction using Terminator™ 5′-Phosphate-Dependent Exonuclease (Lucigen TER51020) as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of rRNA-depleted RNA were treated with 1 U Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in the 1x Buffer A in the presence of 40 U RNaseOUT in a 50 μL reaction at 30 °C for 1 h ...
-
bioRxiv - Genomics 2022Quote: ... oligonucleotide with or without a 5’phosphate or circularized oligonucleotide) were treated with 1 U Terminator exonuclease (Lucigen) or mock treated in the manufacturer’s Buffer A for 1 h at 37 °C followed by 1 h at 30 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the (+)SHAPE and (−)SHAPE RNA samples were treated with Terminator™ 5′-Phosphate-Dependent Exonuclease (TER51020, EPICENTRE co.), which processively digests RNA with 5′-monophosphate ends ...
-
bioRxiv - Biochemistry 2023Quote: HI-Control™ BL21(DE3) (Lucigen) cells were transformed with plasmid and single colonies were picked to start overnight cultures in LB medium supplemented with 50 μg/mL kanamycin at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs and other uncapped RNA species were depleted from RNA samples using the Terminator™ 5’-Phosphate-Dependent Exonuclease (Lucigen). Following a standard phenol-chloroform-isoamyl precipitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5 µg of total RNA was mixed with 3 µl of diluted ERCC RNA spike-in mix and then digested for 1h at 30°C with 1 unit of Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in 1X Reaction Buffer A containing 10 units of SUPERase-In RNase inhibitor (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: 10ug of Trizol-extracted RNA from mouse cortex and striatum was treated with Terminator 5’-Phosphate dependent exonuclease (Lucigen TER51020) according to manufacturer’s protocol. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μg RNA extracted from the specific tethering assays was incubated in a 20 μl reaction volume with 1 unit of Terminator 5’- phosphate-dependent exonuclease (Epicentre) for 60 min at 30°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Microbiology 2022Quote: ... Escherichia coli BL21(DE3) Hi-Control (Lucigen) was used as an expression host for heterologous expression of HpuA ...
-
bioRxiv - Molecular Biology 2022Quote: ... The amplified products and the linearized N-his pETite vector were transformed in HI-Control10G Chemically Competent Cells (Lucigen) and plated on LB plates supplemented with 50 μg/ml kanamycin (Kan) ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... and were cloned into the pETite C-His vector (Lucigen) with a C-terminal hexahistidine tag ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Protein purification was accomplished using the pETite N-His vector (Lucigen). PCR primers were designed to amplify products for BT2807 and BT2808 containing all amino acids downstream of the predicted signal peptide sequences ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant phagmids were electroporated into TG1 cells (Lucigen, USA). A VHH library of 7.3 × 106 individual clones was obtained.
-
bioRxiv - Microbiology 2019Quote: ... amplified and transformed into Hi-Control 10G cells according to manufactures protocol (Lucigen, Expresso™ T7 cloning and expression system) ...
-
bioRxiv - Cell Biology 2023Quote: ... and His-SUMO-N was inserted into the backbone of pETite-HisSUMO (Lucigen) using NEBuilder HiFi DNA Assembly Master Mix kit (NEB ...
-
bioRxiv - Immunology 2019Quote: The recombinant plasmids were transformed into ClearColi-BL21 (DE3) electrocompetent cells (Lucigen) by heat-shock transformation ...
-
bioRxiv - Microbiology 2022Quote: ... was resuspended in TE and introduced into BL21(DE3) Hi-Control chemically competent cells (Lucigen), which were selected on LB plates supplemented with kanamycin.
-
bioRxiv - Microbiology 2021Quote: ... 5’PPP structures were then converted into 5’P ends using RNA 5’ Polyphosphatase (5’PP, Epicentre), to which RNA adapters were ligated ...