Labshake search
Citations for Lucigen :
1 - 50 of 56 citations for QuantiQuik Oxalate Quick Test Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 50 µL of Quick Extract (Lucigen) was added to the cell pellet and the cell mixture was transferred to a 96-well PCR plate (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: Quick extract DNA extraction solution (Lucigen) was tested in accordance with the manufacturer’s suggested buffer to sample ratio ...
-
bioRxiv - Genetics 2024Quote: ... DNA Quick Extract (Lucigen # 76081-766) was used to isolate DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... For RNase III tests 1 unit of enzyme (Epicentre) was added 10 min after addition of RNases I and H ...
-
bioRxiv - Synthetic Biology 2020Quote: ... followed by resuspension in Quick Extract (Lucigen). Samples were vortexed at top speed for 15 seconds ...
-
bioRxiv - Genetics 2022Quote: ... 20uL of Quick Extract buffer (Lucigen QE0905T) was added ...
-
bioRxiv - Genetics 2023Quote: ... Cells were harvested using Quick Extract (Lucigen) per the manufacturer’s instructions beginning at 2 days after transfection until 6 days after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by chromosomal DNA isolation (Quick Extract /Lucigen), PCR amplification (Sup Table 8 ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were harvested using Quick Extract solution (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested using Quick Extract solution (Lucigen). Amplicons were generated with Phusion Flash High-Fidelity 2x Mastermix (F548 ...
-
bioRxiv - Genetics 2020Quote: ... Worms were lysed in DNA Quick Lysate (Epicentre Technologies) for 1 hour at 60°C and the lysate was then used as a template for PCR with Q5 Hot Start High-Fidelity DNA Polymerase (NEB) ...
-
bioRxiv - Neuroscience 2022Quote: 30 µl of Quick Extract DNA Estraction (Lucigen, QE09050,) was added to 5.0 x 104 pelleted iPSC ...
-
bioRxiv - Genetics 2023Quote: ... The cell pellet was resuspended in Quick-Extract (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: To test the Terminator™ 5’-phosphate-dependent exonuclease (Lucigen, Cat. # TER5120), 100 ng of total RNA in 2 μL was combined with 18 μL TEX mix ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA was isolated (Quick Extract DNA extraction solution, Lucigen), amplified by PCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... whereas organoid samples were directly added to Quick Extract (Lucigen), and vortexed ...
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
bioRxiv - Bioengineering 2019Quote: ... genomic DNA was extracted from cells using Quick Extract (Lucigen, QE09050) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Developmental Biology 2020Quote: ... 100,000 iPSCs were taken for DNA extraction using Quick Extract (Lucigen), whereas organoid samples were directly added to Quick Extract (Lucigen) ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were incubated for 72h and harvested with Quick Extract (Lucigen). Genomic DNA was amplified using genomic region-specific primers (Supplemental) ...
-
bioRxiv - Genetics 2023Quote: ... Cell pellets were resuspended in 50 µL of Quick Extract (Lucigen), and genomic DNA was prepared per the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: ... Samples were incubated for 72h and harvested with Quick Extract (Lucigen). Genomic DNA was amplified and sequenced as described above.
-
bioRxiv - Genomics 2020Quote: ... washed with PBS and resuspended in 200 μL of Quick Extract (Lucigen) lysis buffer and cells were lysed according to the manufacture’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... approximately 30,000 cells were lysed in 25ul Quick Extract Buffer (Lucigen #QE09050), according to the manufacturer’s directions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and genomic DNA was isolated using a Quick-Extract Buffer (Lucigen GE09050). Successful heterozygous deletion lines were identified using the PCR primers CCCCCACCCATCAGTCATTC and GGTTGTGCCTCATAGTGCCT and Q5 Polymerase (NEB M0491S) ...
-
bioRxiv - Bioengineering 2024Quote: ... with final resuspension into 30 µl of Quick Extract™ reagent (Lucigen). For mutagenesis analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... the genomic DNA of edited cells were extracted using Quick Extraction kit (Lucigen). Target sites carrying gene-edited sequences were PCR amplified using gene-specific primers (Additional file 2 ...
-
bioRxiv - Microbiology 2020Quote: Saliva samples were treated with the Quick ExtractTM DNA Extraction Solution (QE, Lucigen) by mixing 50 μl of saliva with 50 μl of the QE reagent and heating for 5 minutes at 95°C ...
-
bioRxiv - Cancer Biology 2021Quote: DNA was extracted from cells using Quick Extract (Lucigen, Wisconsin, USA, Cat #QE09050) and amplified using primer pairs listed in Table S4 designed to amplify 66-80 base pair segments containing the predicted cut site for each of our gRNAs listed in Table of gRNAs ...
-
bioRxiv - Genomics 2021Quote: ... and then were resuspended in 385 µL DNA Quick Extract (Lucigen cat# QE09050) and transferred to a 1.5 mL tube ...
-
bioRxiv - Bioengineering 2023Quote: Edited cells were harvested and treated with Quick Extraction solution (Epicentre, Madison, WI) to lyse the cells (65 °C for 20 min and then 95 °C for 20 min) ...
-
bioRxiv - Immunology 2024Quote: ... CD4+ T cells were collected and gDNA was isolated with Quick Extract (Lucigen) following manufacturer instructions ...
-
bioRxiv - Bioengineering 2023Quote: Edited cells were harvested and treated with Quick Extraction solution (Epicentre, Madison, WI) to lyse the cells (65 °C for 20 min and then 95 °C for 20 min) ...
-
bioRxiv - Genomics 2019Quote: ... DNA from surviving clones (194/1200) was isolated using DNA quick extract solution (Lucigen) following a modified protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... the media was removed by aspiration and 100μl of Quick Extraction solution (Epicentre, Madison, WI) was added to lyse the cells (65°C for 20 min and then 95°C for 20 min) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Genomic DNA from 5,000 - 50,000 CAR-expressing T cells was extracted using Quick Extract (Lucigen) and used as the template for a 2-step PCR strategy ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and genomic DNA was extracted using 50 μL of Quick Extract DNA Extract Solution (Lucigen, QE09050) per well according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: For single cell clones or bulk sequencing genomic DNA (gDNA) was extracted by quick extract (Lucigen). PCR amplification was performed with LongAmp Polymerase (NEB ...
-
bioRxiv - Genetics 2024Quote: Genomic DNA from ear punches was isolated using Quick Extract DNA Extraction Solution (Lucigen., Cat# QE09050). All genotyping PCRs were carried out using MyTaq™ Red Mix (Bioline ...
-
bioRxiv - Genetics 2021Quote: ... genomic DNA from bulk cells of each transfected well was extracted using Quick Extract buffer (Lucigen #QE0905T). following the protocol published by the manufacturer (https://www.lucigen.com/docs/manuals/MA150E-QuickExtract-DNA-Solution.pdf) ...
-
bioRxiv - Cancer Biology 2021Quote: ... These primers were used to amplify cell pools after DNA extraction using Quick Extract (Lucigen, Wisconsin, USA, Cat #QE09050). Amplified reads were sequenced on either an Illumina MiSeq or Illumina HiSeq 2500.
-
bioRxiv - Immunology 2019Quote: ... washed once in PBS and genomic DNA was recovered from 1 x 106 cells using 100 μl Quick Extract solution (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... DNA was isolated from tail snips of MyD88 CRISPy TAKO and Mock-treated control offspring using Quick Extract (Lucigen, #QE09050). Primers for MyD88 genotyping are listed in Table 1 ...
-
bioRxiv - Microbiology 2020Quote: Samples were analyzed directly or mixed 1:1 with one of the following buffers: Quick Extract DNA Extraction Solution (Lucigen), Virotype Tissue Lysis Reagent (INDICAL BIOSCIENCE GmbH ...
-
bioRxiv - Molecular Biology 2020Quote: ... Comparable results to commercial RNA extraction kits have been obtained using a 5-min direct detection preparation method of nasopharyngeal samples following 1:1 dilution with the Quick Extract DNA extraction Solution (Lucigen) (6) ...
-
bioRxiv - Genetics 2021Quote: ... and four CS (line 403 subclones 1, S7, S8, and S9) iPSC lines was extracted using quick extract DNA extraction solution (Epicentre #QE09050), amplified by PCR ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were washed once with DPBS and genomic DNA (gDNA) was extracted with 50 µL/well of Quick-Extract solution (Lucigen, QE09050). Lysates were pipetted up and down thoroughly ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the plates was used for quick genomic DNA isolation for each of the colonies using QuickExtract DNA extraction solution (Lucigen # QE09050). 5μl of this lysate was used to set up a quick genomic PCR screening for IL-1β knockout clones using checking primers ...