Labshake search
Citations for Lucigen :
1 - 50 of 750 citations for Protein DNA Interaction Assay since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... C-circle and G-circles assays were performed as before except that NxGen phi29 DNA Polymerase (Lucigen Corp.) were used for rolling circle amplifications [25].
-
bioRxiv - Molecular Biology 2021Quote: ... C-circle and G-circles assays were performed as before except that NxGen® phi29 DNA Polymerase (Lucigen Corp.) were used for rolling circle amplifications [25].
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted using DNA QuickExtract (Lucigen), and qPCR was performed using iTaq Universal SYBR Green (Bio-rad ...
-
bioRxiv - Microbiology 2021Quote: ... eDNA was purified from the samples by removing the proteins and RNA using MasterPure Gram Positive DNA Purification Kit (Epicentre, Madison, WI, USA), and the DNA concentration was measured using NanoVue Plus (GE Healthcare ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA was extracted (DNA extraction solution, Epicentre Biotechnologies) and edited regions were specifically amplified by PCR (primers are listed in Supplementary Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from using DNA QuickExtract (Lucigen). Amplicons for indel analysis were generated by PCR amplification ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted using DNA QuickExtract (Lucigen #QE09050). Cells were lysed in 50 μL of QuickExtract solution and incubated at 68°C for 15 min followed by 95°C for 10 min ...
-
bioRxiv - Genetics 2023Quote: ... DNA was isolated using QuickExtract DNA Solution (Lucigen) and amplicons were generated using 15 cycles of PCR to introduce Illumina sequencing primer binding sites and 0-8 staggered bases to ensure library diversity ...
-
Weak Membrane Interactions Allow Rheb to Activate mTORC1 Signaling Without Major Lysosome EnrichmentbioRxiv - Cell Biology 2019Quote: ... DNA was extracted (QuickExtract DNA extraction solution; Epicentre Biotechnologies), the region of interest was amplified by PCR (primers summarized in Table S3) ...
-
bioRxiv - Genetics 2020Quote: DNA was isolated using QuickExtract DNA extract solution (Lucigen) for PCR grade DNA or the QIAamp DNA mini kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA extraction using QuickExtract DNA Extraction Solution (Lucigen) was performed according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNAs were prepared using QuickExtract DNA Extraction Solution (Lucigen) following the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was purified using MasterPure Yeast DNA purification Kit (Epicentre) according to the manufacturer’s specifications ...
-
bioRxiv - Microbiology 2019Quote: ... Total DNA was purified using Masterpure DNA Purification kit (Epicentre), and prepared for TnSeq by PCR amplification of transposon:genome junctions and adapter ligation following the protocol in [53] ...
-
bioRxiv - Molecular Biology 2020Quote: ... cellular genomic DNA was extracted using QuickExtract DNA solution (Epicentre) and the Gaac.1826 target locus was PCR amplified and purified using DNA Clean & Concentrator™ (Zymo Research ...
-
bioRxiv - Genomics 2022Quote: DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen), depending on confluency 25 to 100 μl of solution was added to the wells containing the cells for 15 minutes at 37C ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was purified using MasterPure Yeast DNA purification Kit (Epicentre) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA was isolated (Quick Extract DNA extraction solution, Lucigen), amplified by PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... genomic DNA was extracted using Quickextract DNA extraction solution (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA was isolated using QuickExtract DNA Extraction Solution (Lucigen). PCR amplified target sequence was heated to 95°C and slowly (2C/s ...
-
bioRxiv - Bioengineering 2020Quote: ... genomic DNA was isolated using QuickExtract DNA Extraction Solution (Epicentre). Two sets of PCR primers were designed ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA was purified using MasterPure Yeast DNA purification Kit (Epicentre) and small DNA fragments were preserved by purification with AMPure beads (Agencourt ...
-
bioRxiv - Genomics 2021Quote: DNA was extracted with the MasterPure DNA purification kit (Lucigen). Libraries were prepared using the Illumina TruSeq PCR-free library preparation kit and sequencing was performed on the Illumina NextSeq500 with 75bp single-end reads (first experiment) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Yolk-sac DNA was extracted (QuickExtract DNA Extraction Solution, Epicentre) and used for genotyping to distinguish heterozygous and homozygous Hand2 conditional allele ...
-
bioRxiv - Genetics 2023Quote: ... DNA was extracted with the MasterPure DNA purification kit (Lucigen). Libraries were prepared using the Illumina TruSeq PCR-free library preparation kit ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was harvested using QuickExtract DNA Extraction Solution (Lucigen), and gDNA was prepared by heating to 65°C for 10 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Microbiology 2022Quote: ... Protein precipitation reagent (Lucigen) was added and samples were spun at maximum speed ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was extracted using the Masterpure Complete DNA Purification Kit (Lucigen-Biosearch Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated DNA using the End-It DNA End-Repair Kit (Lucigen). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Evolutionary Biology 2019Quote: DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre). A genotyping-by-sequencing protocol was modified from microsatellite library preparation and ddRAD sequencing approaches as follows (Nolte ...
-
bioRxiv - Microbiology 2019Quote: Total DNA was isolated using Masterpure Complete DNA Isolation kit (Epicentre). PCR to confirm presence of transposon was preformed using GoTaq® Green Master Mix (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using QuickExtract genomic DNA extraction solution (Epicentre Biotechnologies) and then screened by PCR amplification of the region of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... genomic DNA was extracted using QuikExtract DNA reagent (Lucigen, Middleton, WI). Except where noted ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA was isolated from obtained clones using DNA QuickExtract (Lucigen), the sgRNA-targeted sites PCR amplified and the products Sanger-sequenced ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Neuroscience 2022Quote: ... ChIP DNA was end-repaired (End-it DNA Repair kit; Epicentre) and A-tailed (Klenow Exo-minus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies).
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies). C9ORF72 targeting sgRNA1 ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Molecular Biology 2021Quote: ... phosphorylated DNA using the End-It DNA End-Repair Kit (Lucigen). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted (using MasterPure Yeast DNA Purification Kit; Epicentre, UK) from stationary phase and re-growth cultures for selected timepoints (Days 0 ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA was isolated with QuickExtract™ DNA Extraction Solution (Lucigen) and targeted sequences were amplified by PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA was extracted using the QuickExtract DNA extraction kit (Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and genomic DNA were extracted using QuickExtract DNA Extraction Solution (Epicentre). PCR amplification products of the mutation site were used in restriction fragment length polymorphism assays with the AluI restriction enzyme (NEB ...
-
bioRxiv - Genetics 2023Quote: ... DNA were extracted using MasterPure yeast DNA purification kit (Epicentre, MPY80200). ChEC DNA was subjected to size selection using the Pippin Prep (SageScience ...