Labshake search
Citations for Lucigen :
1 - 50 of 78 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
bioRxiv - Genetics 2020Quote: ... PCR was performed using EconoTaq and associated PCR reagents (Lucigen) with 4 μL of crude DNA lysate created as described previously 24 from ear punch biopsy specimens of 8 to 14-day-old mice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genotyping PCR was performed using Failsafe PCR 2x PreMix H (Lucigen) and Taq polymerase (NEB).
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using gene specific primers and EconoTaq PCR Master Mix (Lucigen) per the manufacturer’s guidelines (18 cycles for S14 and 24 cycles for U6) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR-free library preparation (Lucigen) and NextSeq 500 sequencing (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... The libraries were amplified with 10 PCR cycles using the FailSafe PCR enzyme (Illumina/Epicentre). Libraries were quality controlled on a TapeStation 2200 HSD1000.
-
bioRxiv - Genomics 2019Quote: ... 1 μL Reverse PCR Primer (Epicentre), 1 ng of cDNA library ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 ng of each sample were PCR amplified using the FailSafe PCR system with PreMix H (Lucigen). Southern blot-based detection of telomere PCR products was modified from previous protocols 48,49 ...
-
bioRxiv - Microbiology 2022Quote: ... was performed in a two-step barcoded PCR protocol using the FailSafe PCR PreMix (Lucigen, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Molecular Biology 2023Quote: ... Standard PCRs were performed using StartWarm HS-PCR Mix (A&A Biotechnology) or EconoTaq PLUS2X Master Mix (Lucigen). PCR products were analyzed with 1.5% agarose gel containing GelRed (Biotium ...
-
bioRxiv - Genomics 2019Quote: ... 1 μL ScriptSeq Index PCR Primer (Epicentre), 1 μL Reverse PCR Primer (Epicentre) ...
-
bioRxiv - Molecular Biology 2021Quote: ... For the subsequent PCR the Econo-Taq (Lucigen) master mix was used with forward (5’-TGACTATCCTAGAAATCGCTGTCG ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (ii) Shotgun PCR-free library preparation kit (Lucigen) or (iii ...
-
bioRxiv - Biochemistry 2020Quote: ... The standard PCR reaction was performed with the HNqPCRrev1 and HNqPCRfrw1 primers using the Failsafe PCR system with the Premix A (Lucigen, catalog # F599100). Positive and negative PCR control reactions with or without 50ng of HNDNA ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... and primers outlined in Table S1. E. coli colony PCRs (Fig. 1F and Fig. S1F- H) were performed with CloneID 1X Colony PCR Mix (Lucigen 30059-2) and primers outlined in Table S1.
-
bioRxiv - Developmental Biology 2021Quote: Founder mice were genotyped using FailSafe PCR Kit (EpiCentre) and run on a 12% polyacrylamide gel for heteroduplex assay ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR product was in vitro transcribed (Epicentre, ASF3507) under the control of promoter T7 for 12 hours at 37°C and DNAse treated with TURBO-DNAse for 20 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... FailSafe®PCR Enzyme Mix (Epicentre, Madison, WI, USA) and ScriptSeq®Index PCR Primers (Epicentre ...
-
bioRxiv - Molecular Biology 2022Quote: ... Complete cDNAs were sequence-amplified by PCR using KOD One™ PCR Master Mix -Blue- (TOYOBO, Japan) and were cloned into pSMART-LCK plasmid (Lucigen, Middleton, WI, USA) containing a T7 RNA polymerase promoter ...
-
bioRxiv - Plant Biology 2021Quote: ... which were indexed using ScriptSeq Index PCR Primers (RSBC10948, Epicentre). Sequencing was performed on an Illumina HiSeq instrument (Microgen ...
-
bioRxiv - Plant Biology 2021Quote: ... 6.5 ul FailSafe™ PCR 2X PreMix J (Lucigen, Middleton), 0.5 ul Taq DNA polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CAGs-rtTA3 PCRs using EconoTaq PLUS (Lucigen #30033-2). Doxycycline chow (food pellets ...
-
bioRxiv - Genetics 2019Quote: ... 5 μL FailSafe 2× PCR premix G (EpiCentre, Madison, Wisconsin), approximately 25 ng genomic DNA template ...
-
bioRxiv - Microbiology 2024Quote: ... and ScriptSeq®Index PCR Primers (Epicentre, Madison, WI, USA) for amplification and barcoding of di-tagged cDNA ...
-
bioRxiv - Neuroscience 2022Quote: ... Offspring genotypes were confirmed by PCR (Lucigen EconoTaq Plus GREEN 2X) and both heterozygous and homozygous ChAT-cre/jRGECO1a mice were used in the experiments and no phenotypic difference were observed.
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were then in vitro transcribed with T7 polymerase (Lucigen). Capture SELEX was then carried out as follows ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Colony PCR was performed as follows: 2X EconoTaq Master mix (Lucigen) was used in 20 µL PCR reactions consisting of 10µL of 2X EconoTaq Master mix (Lucigen) ...
-
bioRxiv - Genetics 2020Quote: ... using their associated buffers or alternatively FailSafe PCR PreMix buffers (Epicentre). Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... the ScriptSeq™ Index PCR Primers (Sets 1 to 4) and the FailSafe™ PCR enzyme system (all sourced from Epicentre®/Illumina® Inc., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre, Illumina) following the standard protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR was carried out using EconoTaq PLUS GREEN 2x master mixes (Lucigen) and primers for target genes and control housekeeping genes ...
-
bioRxiv - Biophysics 2023Quote: ... was generated by OE PCR using EconoTaq PLUS 2x Master Mix (Lucigen) with primers listed in Table S9 ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in PCR master mix (EconoTaq PLUS 2× Master Mix, Lucigen), the DNA was amplified for 15 cycles and purified (QIAGEN) ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR genotyping was performed using the EconoTaq Plus Green 2X Master Mix (Lucigen) and primer pairs for wild-type and Chd4 floxed alleles (Table 1) ...
-
bioRxiv - Biophysics 2019Quote: ... The PCR products were sub-cloned into pGCBlue (Lucigen, pGCBlue Cloning and Amplification kit) or pMiniT (NEB PCR cloning kit ...
-
bioRxiv - Bioengineering 2020Quote: ... in 10 μL PCR reactions consisting of 5μL of 2X EconoTaq Master mix (Lucigen), 1uL of each primer (10μM) ...
-
bioRxiv - Microbiology 2021Quote: ... beads and multiplexed by using ScriptSeq Index PCR Primers (Epicentre, Illumina, Madison, WI USA). cDNA libraries were quantified by using KAPA Illumina Library Quantification kit (KAPA Biosystems ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR fragments were then in vitro transcribed using the AmpliScribe T7-Flash kit (Lucigen) with overnight incubation at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: Then the PCR products were ligated into vector pSmart LC Kn (Lucigen, cat.# 40821) and electroporated into E ...
-
bioRxiv - Genetics 2020Quote: ... for qRT-PCR and northern blotting and MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen) for RNA-seq ...
-
bioRxiv - Genetics 2020Quote: ... for qRT-PCR and northern blotting and MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen) for RNA-seq ...
-
bioRxiv - Molecular Biology 2021Quote: Eluted cDNA was moved to a new PCR tube and mixed with CircLigase II (Epicentre) reaction mix containing ...
-
bioRxiv - Microbiology 2023Quote: ... each DNA sample was amplified in triplicate using the FailSafe™ PCR System (Epicentre, WI) and the 515FB-806RB primer pair to generate a 400 bp amplicon from the V4 variable regions of the 16S rRNA gene ...
-
bioRxiv - Genomics 2021Quote: The DNA libraries for Illumina sequencing were prepared using a Shotgun PCR-free library preparation (Lucigen) Illumina Library at the McGill University and Genome Quebec Innovation Center (Montréal ...
-
bioRxiv - Microbiology 2020Quote: ... Purified PCR products were ligated into the pETite vector containing an N-terminal His6 tag (Lucigen) and transformed into HI-Control 10G cells ...
-
bioRxiv - Synthetic Biology 2020Quote: ... was used in 20 µL PCR reactions consisting of 10µL of 2X EconoTaq Master mix (Lucigen), 1uL of each primer (10uM concentration) ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was carried out with EconoTaq PLUS GREEN 2X Master Mix (cat# 30033-1; Lucigen) and an initial denaturation at 94°C for 2 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μl from PCR reaction aliquots were transformed in electrocompetent E.coli Cloni® 10G cells (Lucigen, USA). Colonies were screened by colony PCR and positive colonies were sequenced ...
-
bioRxiv - Microbiology 2022Quote: ... difficile colonies on TCCFA were transferred to 25 µL of PCR-Lyse™ (Epicentre, Madison, WI, USA) solution ...