Labshake search
Citations for Lucigen :
1 - 50 of 189 citations for PCR Buffers since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... using their associated buffers or alternatively FailSafe PCR PreMix buffers (Epicentre). Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Developmental Biology 2020Quote: ... Aliquots from these lysates were used for a PCR (with a Taq DNA polymerase with standard Taq buffer NEB or EconoTaq DNA polymerase Lucigen) with respective gene primers and an 18mer M13F-FAM fluorescent tagged primer (5’-TGTAAAACGACGGCCAGT-3’ ...
-
bioRxiv - Genetics 2020Quote: ... PCR was performed using EconoTaq and associated PCR reagents (Lucigen) with 4 μL of crude DNA lysate created as described previously 24 from ear punch biopsy specimens of 8 to 14-day-old mice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genotyping PCR was performed using Failsafe PCR 2x PreMix H (Lucigen) and Taq polymerase (NEB).
-
bioRxiv - Biochemistry 2020Quote: buffer supplied from Epicentre in the AmpliScribe T7 High Yield Transcription Kit.
-
bioRxiv - Developmental Biology 2021Quote: ... or Buffer J (EpiCentre) with Taq Polymerase (Roche).
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using gene specific primers and EconoTaq PCR Master Mix (Lucigen) per the manufacturer’s guidelines (18 cycles for S14 and 24 cycles for U6) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR-free library preparation (Lucigen) and NextSeq 500 sequencing (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... 1× transcription buffer (Epicentre Technologies), 125 μCi of 35S-labeled UTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Failsafe Buffer D (Epicentre). PCR products were run on a 1% agarose gel and imaged using a Gel Doc XR+ (Bio-Rad).
-
bioRxiv - Molecular Biology 2024Quote: ... and 1.5× ampligase buffer (Lucigen). The initial denaturation at 94°C for 5 minutes was followed by ramping down to 60°C (−0.1°C/s ...
-
bioRxiv - Genomics 2021Quote: ... The libraries were amplified with 10 PCR cycles using the FailSafe PCR enzyme (Illumina/Epicentre). Libraries were quality controlled on a TapeStation 2200 HSD1000.
-
bioRxiv - Genomics 2019Quote: ... 1 μL Reverse PCR Primer (Epicentre), 1 ng of cDNA library ...
-
bioRxiv - Microbiology 2020Quote: ... 2 µl TEX reaction buffer (Lucigen) and 0.5 µl RiboGuard RNase Inhibitor (Lucigen ...
-
bioRxiv - Genomics 2020Quote: ... 2 mL of recovery buffer (Lucigen) was added ...
-
bioRxiv - Biochemistry 2020Quote: ... PAP dedicated buffer and PAP (Lucigen) from 0.05 to 0.2 U/μL reaction ...
-
bioRxiv - Neuroscience 2020Quote: ... and Failsafe buffer J (Epicentre Biotechnologies) at a final concentration of 1X ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1× CircLigase II buffer (Lucigen, CL9021K), and 2.5 mM MnCl2 was added to 16 µL of cDNA and incubated at 60°C for 100 min followed by 80°C for 10 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and FailSafe™ Buffer J (Epicentre) and resolved on a 1% agarose TBE gel.
-
bioRxiv - Cell Biology 2021Quote: ... 20 ng of each sample were PCR amplified using the FailSafe PCR system with PreMix H (Lucigen). Southern blot-based detection of telomere PCR products was modified from previous protocols 48,49 ...
-
bioRxiv - Microbiology 2022Quote: ... was performed in a two-step barcoded PCR protocol using the FailSafe PCR PreMix (Lucigen, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Standard PCRs were performed using StartWarm HS-PCR Mix (A&A Biotechnology) or EconoTaq PLUS2X Master Mix (Lucigen). PCR products were analyzed with 1.5% agarose gel containing GelRed (Biotium ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were lysed with 1 ml mammalian lysis buffer containing 200 µl 5x Mammalian Polysome Buffer (Epicentre, RPHMR12126), 100 µl 10% Triton X-100 ...
-
bioRxiv - Genomics 2019Quote: ... 1 μL ScriptSeq Index PCR Primer (Epicentre), 1 μL Reverse PCR Primer (Epicentre) ...
-
bioRxiv - Bioengineering 2019Quote: ... and 1 μL 10X ampligase buffer (Lucigen). Circularization was achieved under the following conditions ...
-
bioRxiv - Genomics 2021Quote: ... 10uL 10x OmniAmp buffer (Lucigen, F883707-1), 8uL dNTP (NEB ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 10X transcription buffer (Epicentre Technologies Madison, WI), 3 μL of S-35-labeled UTP ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Ampligase® Reaction Buffer (Lucigen), 10 U Ampligase (Lucigen) ...
-
bioRxiv - Genetics 2022Quote: ... 20uL of Quick Extract buffer (Lucigen QE0905T) was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 1× RNase R buffer (#RNR07250; Epicentre) in a 10 µl reaction volume at 37 °C for 10 min followed by heat inactivation at 95 °C for 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 30 μg of lysate was diluted to 200 μL in polysome buffer (lysis buffer without Triton X-100) and 1.5 μL RNase I was added (Epicentre #N6901K). RNase digestion was carried out at 200 rpm at 37°C for 45 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... For the subsequent PCR the Econo-Taq (Lucigen) master mix was used with forward (5’-TGACTATCCTAGAAATCGCTGTCG ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (ii) Shotgun PCR-free library preparation kit (Lucigen) or (iii ...
-
Efficient CRISPR/Cas9 genome editing in a salmonid fish cell line using a lentivirus delivery systembioRxiv - Genetics 2019Quote: Genomic DNA was extracted with QuickExtract buffer (Lucigen) by adding 30 µL to a single well of a 96-well plate and incubating for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was extracted using QE buffer (Lucigen) and PCR was performed using Q5 polymerase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... The standard PCR reaction was performed with the HNqPCRrev1 and HNqPCRfrw1 primers using the Failsafe PCR system with the Premix A (Lucigen, catalog # F599100). Positive and negative PCR control reactions with or without 50ng of HNDNA ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... and primers outlined in Table S1. E. coli colony PCRs (Fig. 1F and Fig. S1F- H) were performed with CloneID 1X Colony PCR Mix (Lucigen 30059-2) and primers outlined in Table S1.
-
bioRxiv - Developmental Biology 2021Quote: Founder mice were genotyped using FailSafe PCR Kit (EpiCentre) and run on a 12% polyacrylamide gel for heteroduplex assay ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR product was in vitro transcribed (Epicentre, ASF3507) under the control of promoter T7 for 12 hours at 37°C and DNAse treated with TURBO-DNAse for 20 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... FailSafe®PCR Enzyme Mix (Epicentre, Madison, WI, USA) and ScriptSeq®Index PCR Primers (Epicentre ...
-
bioRxiv - Genomics 2022Quote: ... 1x Ampligase DNA ligase buffer (Epicentre Technologies, Madison, WI), 0.5 μl of 5M Betain (Sigma Aldrich) ...
-
bioRxiv - Genomics 2022Quote: ... and split into 6-well culture for expansion and into lysis buffer for DNA extraction (homemade by GESC, formulation identical to Lucigen Quick-Extract buffer). PCRs were performed with Platinum Superfi II 2x master mix (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... Complete cDNAs were sequence-amplified by PCR using KOD One™ PCR Master Mix -Blue- (TOYOBO, Japan) and were cloned into pSMART-LCK plasmid (Lucigen, Middleton, WI, USA) containing a T7 RNA polymerase promoter ...
-
bioRxiv - Plant Biology 2021Quote: ... which were indexed using ScriptSeq Index PCR Primers (RSBC10948, Epicentre). Sequencing was performed on an Illumina HiSeq instrument (Microgen ...
-
bioRxiv - Plant Biology 2021Quote: ... 6.5 ul FailSafe™ PCR 2X PreMix J (Lucigen, Middleton), 0.5 ul Taq DNA polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CAGs-rtTA3 PCRs using EconoTaq PLUS (Lucigen #30033-2). Doxycycline chow (food pellets ...
-
bioRxiv - Genetics 2019Quote: ... 5 μL FailSafe 2× PCR premix G (EpiCentre, Madison, Wisconsin), approximately 25 ng genomic DNA template ...
-
bioRxiv - Microbiology 2024Quote: ... and ScriptSeq®Index PCR Primers (Epicentre, Madison, WI, USA) for amplification and barcoding of di-tagged cDNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1x reaction buffer (Epicentre cat no. RT80125K and RG90910K). RNA and random decamer primer were first incubated at 85°C for 3 minutes and then incubated on ice for 2 minutes during which remaining reaction components were added ...