Labshake search
Citations for Lucigen :
1 - 31 of 31 citations for Nucleic Acid Electrophoresis Gel since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Free nucleic acids were digested using OmniCleave Endonuclease (Lucigen, USA) for 30 minutes ...
-
bioRxiv - Genomics 2020Quote: ... Nucleic acids were extracted using MasterPure yeast DNA purification kit (Epicentre, MPY80200) according the manufacturer’ instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted using the Epicentre MasterPure nucleic acid extraction kit (Epicentre, Madison, WI) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from the Sterivex filters using the Masterpure™ Nucleic Acid Extraction Kit (Epicentre). Six-hundred microliters of Masterpure™ Tissue and Cell Lysis Solution containing recommended quantities of proteinase K were added to each Sterivex filter ...
-
bioRxiv - Developmental Biology 2023Quote: ... We exposed the nucleic acids of each embryo with 5µl of QuickExtract™ DNA Extraction Solution (Lucigen, VWR, Philadelphia, PA), and incubated at 65°C for 15 minutes followed by 2 minutes at 98°C.
-
bioRxiv - Genomics 2020Quote: ... Dual extraction of nucleic acid (RNA and DNA) from each pupa was carried out using the MasterPure dual extraction kit (Epicentre, MC85200). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acid extraction from blood samples was performed using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, LGC Ltd, Teddington, GB). For metagenomic analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tobacco Acid Pyrophosphatase (Epicentre, discontinued) or recombinant PIR-1 was used to dephosphorylate ppp-RNAs for cloning ppp-RNAs when needed while no such treatment was required for cloning p-RNAs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tobacco acid pyrophosphatase (TAP, Epicentre) was added to convert 5′ PPP or capped RNAs to 5′ P RNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were incubated with Tobacco Acid Pyrophosphatase (Epicentre) and washed once with wash buffer ...
-
bioRxiv - Microbiology 2020Quote: ... gel purified and circularised using CircLigase (Epicentre) for 1h at 60° C followed by heat inactivation for 10min at 80°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Truncated cDNAs (120-170nt) were size selected from denaturing polyacrylamide gels and gel purified cDNAs were circularized with CircLigase ssDNA ligase (Epicentre). Circularized cDNAs were PCR amplified with forward primer (AATGATACGGCGACCACCGA ...
-
bioRxiv - Microbiology 2021Quote: ... Purified RNAs were then treated with TAP (Tobacco Acid Pyrophosphatase, Epicentre) to convert 5′ ends of RNA to monophosphate ...
-
bioRxiv - Microbiology 2019Quote: ... DNase-treated RNA was treated with Tobacco Acid Pyrophosphate (TAP) (Epicentre) at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified virus RNA was treated with 5 units of tobacco acid pyrophosphatase (Epicentre) to generate 5’ monophosphorylated termini ...
-
bioRxiv - Molecular Biology 2020Quote: ... and gel-purified RT products circularized using CircLigase II (Lucigen, CL4115K). rRNA depletion was performed using biotinylated oligos as described in (Ingolia et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... and gel-purified RT products circularized using CircLigase II (Lucigen, CL4115K). rRNA depletion was performed using biotinylated oligos as described in (Ingolia et al. ...
-
bioRxiv - Genomics 2023Quote: ... and gel- purified RT products circularized using CircLigase II (Lucigen, CL4115K). rRNA depletion was performed using biotinylated oligos as described36 and libraries constructed using a different reverse indexing primer for each sample.
-
bioRxiv - Genomics 2020Quote: ... Gel-purified cDNAs were then circularized with CircLigase I (Lucigen, Cat: CL4111K) and PCR-amplified with Illumina’s paired-end primers 1.0 and 2.0 ...
-
bioRxiv - Microbiology 2022Quote: ... Gel-purified cDNAs were then circularized with CircLigase II (Lucigen, Cat: CL4115K) and PCR-amplified with Illumina’s paired-end primers 1.0 and 2.0 ...
-
bioRxiv - Microbiology 2023Quote: ... Gel-purified cDNAs were then circularized with CircLigase I (Lucigen, cat. CL4111K) and PCR-amplified with Illumina’s paired-end primers 1.0 and 2.0 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and decapped using Tobacco Acid Pyrophosphatase (TAP) enzyme (Epicentre, can be replaced by RppH from NEB) and purified by phenol/chloroform extraction ...
-
bioRxiv - Cell Biology 2021Quote: ... Fungal genomic acid DNA was isolated with the MasterPureTM Yeast DNA Purification Kit (Lucigen, Wisconsin, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNAs were size-purified on TBE-Urea gels before being circularized by CircLigase II (Epicentre). Circularised cDNAs were then annealed to an oligonucleotide complementary to the BamHI site and then BamHI digested ...
-
bioRxiv - Biochemistry 2021Quote: ... The dsDNA was purified from a 1% agarose gel and electroporated into E.coli SS320 (Lucigen) electrocompetent cells pre-infected with M13KO7 helper-phage (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reverse-transcribed products were then gel-purified and circularized using CircLigase ssDNA Ligase (Epicentre), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and the 5’P of capped molecules was exposed by treatment with 5 units of Tobacco Acid Pyrophosphatase (Epicentre). RNA samples were ligated with the TIF-seq DNA/ RNA 5oligo cap using T4 RNA ligase 1 (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... The vector product was sized and purified from an agarose gel and circularized by end repair/phosphorylation (Lucigen, cat#ER0720) and blunt ended ligation (Lucigen ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments in the range of 30-40 kbp were resolved by gel electrophoresis (2 V cm-1 overnight at 4 °C) and recovered from 1% low melting point agarose gel using GELase 50X buffer and GELase enzyme (Epicentre). Nucleic acid fragments were then ligated to the linearized CopyControl pCC2FOS vector following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Fragments from 500 bp to 1000 bp were excised from an agarose gel and cloned into the pSMART LCKan plasmid (Lucigen) by transforming into competent cells ...
-
bioRxiv - Microbiology 2023Quote: ... The gel-recovered fragments were ligated to the linearized PZE12 vector (prime 3,4) by blunt-end ligation enzyme (Epicentre FastLinkTM kit) and ligation products in the range of 4-10 kb were extracted from a 0.7% agarose gel.