Labshake search
Citations for Lucigen :
1 - 50 of 731 citations for Mouse E3 Ubiquitin Protein Ligase SMURF2 SMURF2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Ligase I (Lucigen) at 68°C for 2 h ...
-
bioRxiv - Synthetic Biology 2019Quote: ... ssDNA adapter ligation was performed using the CircLigase ssDNA ligase kit (#CL4115K, Epicentre). Briefly ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... The size-selected and purified cDNA was circularized using CircLigase ssDNA ligase kit (Lucigen) following manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... circularized with Circ Ligase (Lucigen), and PCR amplified ...
-
bioRxiv - Microbiology 2021Quote: ... Circ Ligase (Epicentre, cat. No. CL4111K), NEBNext® High-Fidelity 2X PCR Master Mix (cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... circularized by CircLigase™ II ssDNA ligase (Lucigen). Subsequently ...
-
bioRxiv - Genetics 2023Quote: ... 4 units of Ampligase® DNA Ligase (Epicentre), 0.2 ul of Ampligase® 10X Reaction Buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Illumina adapters were ligated using Circ Ligase I (Lucigen) and linker pA-Adapt-Bp (Table S5) ...
-
bioRxiv - Genomics 2022Quote: ... 1x Ampligase DNA ligase buffer (Epicentre Technologies, Madison, WI), 0.5 μl of 5M Betain (Sigma Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... 1µl Fast-Link DNA ligase (Lucigen, cat. no. LK6201H), 3 µl 10× Fast link ligation buffer and 1mM ATP ...
-
bioRxiv - Systems Biology 2023Quote: ... and self-ligated using Fast-link ligase (LK0750H; Lucigen). Duplets of 800bp-1000bp were excised from agarose gel ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNAs were circularized using 100U CircLigase I ssDNA ligase (Epicentre), and cDNA concentration was quantified by QPCR of cDNA compared to a standard curve of a reference sample ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of Fast-Link DNA ligase (Lucigen, cat#LK0750H), and milliQ water up to 15 μl total volume ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was circularized with 100 U CircLigase ssDNA Ligase (Lucigen) in the presence of 1X CircLigase Buffer ...
-
bioRxiv - Microbiology 2021Quote: Purified cDNA was subject to circularization via CircLigase ssDNA Ligase (Lucigen) per the manufacturer’s specifications ...
-
bioRxiv - Genomics 2021Quote: ... 1.5 μl ATP and 1 μl FastLink DNA ligase (Lucigen Corporation), followed by heat inactivation for 15 min at 70°C ...
-
bioRxiv - Genetics 2021Quote: ... The remainder was self-ligated using Fast-link ligase (LK0750H; Lucigen), after which duplets of ~800bp were excised from agarose gel and purified (BIO-52059 ...
-
bioRxiv - Microbiology 2020Quote: The resulting cDNA was circularized by 40 U ssDNA ligase (Lucigen) at 60 °C for 4 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... The purified cDNA was then circularized using CircLigaseII ssDNA ligase (Epicentre) for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genomics 2023Quote: ... 0.2 µl of Fast-Link DNA Ligase (Lucigen, cat. no. LK6201H), 1.2 mM ATP ...
-
bioRxiv - Immunology 2023Quote: ... Circular ligation was performed using CircLigase II ssDNA Ligase (Epicentre CL4111K) for 1,5 hours at 60°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted cDNA was circularized with CircLigase II ssDNA ligase (Lucigen, CL9021K) for 1 hr at 60°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cDNA was circularized by CircLigase™ II ssDNA Ligase (Epicentre, CL9025K). Next ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 μl of 2.5 U of CircLigase II ssDNA Ligase (Lucigen), and incubating the resultant mixtures at 40°C for 3 h ...
-
bioRxiv - Bioengineering 2023Quote: ... Ampligase DNA Ligase and 10X Reaction Buffer were purchased from Lucigen (A3202K). 2X GoTaq G2 Hot Start Colorless Master Mix was purchased from Promega (9IM743) ...
-
bioRxiv - Biochemistry 2024Quote: ... The resulting cDNA products were circularized with CircLigase ssDNA ligase (Lucigen, USA). Illumina sequencing adaptors were introduced by PCR and the final library sequenced at the JHU Genetic Resources Core Facility on a HiSeq2500 (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was circularized using T4 RNA ligase 1 (Epicentre or New England BioLabs) and reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli genomic DNA in 15 μL of 1× Ampligase DNA Ligase Buffer (Epicentre) containing 250 ng of unshared E ...
-
bioRxiv - Molecular Biology 2019Quote: ... rRNA was depleted using the Ribo-Zero kit Human/Mouse/Rat (Epicentre), and libraries were prepared using random priming ...
-
bioRxiv - Molecular Biology 2020Quote: ... with ribosomal depletion using Human/Mouse/Rat Ribo-Zero kit (Epicentre/Illumina). All samples were sequenced using a 100 base-pair (bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4μL 50mM MnCl2 and 0.3μL of 100U/μl CicrLigase II ssDNA ligase (Epicentre CL9021K) and incubated in a PCR machine at 60°C for 60 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10pmol of template oligo was cyclized and ligated using CircLigase II ssDNA Ligase (Lucigen) supplemented with 2.5mM MnCl2 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Ampligase Thermostable DNA Ligase for LCR reaction was obtained from Lucigen (Middleton, USA).
-
bioRxiv - Synthetic Biology 2022Quote: ... and 1.5 μL of 5 U μL-1 Ampligase Thermostable DNA Ligase (Lucigen, USA). Water was added to a total volume of 25 μL ...
-
bioRxiv - Systems Biology 2024Quote: ... The reaction was performed overnight at 37℃ using 1x Ampligase ligase buffer (Lucigen, A1905B), 50 mM KCl (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... Gram-negative and Human/mouse/rat Ribo-Zero rRNA Removal Kit (Epicentre Technologies). The resulting RNA was purified using Zymo RNA clean & Contentrator-5 column kit (ZYMO Research) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reverse-transcribed products were then gel-purified and circularized using CircLigase ssDNA Ligase (Epicentre), according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: We extracted genomic DNA from mouse tails using the QuickExtract DNA extraction kit (Epicentre) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Free mRNA and rRNA ends were then ligated into circular forms with a circRNA ligase (Lucigen); it favors ligation events between proximal RNA ends11 and it has limited activity at high temperature ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... recovered and used for the 20 µL circularization reaction (100 U CircLigase™ ssDNA Ligase (Lucigen, CL4111K), 50 mM ATP ...
-
bioRxiv - Microbiology 2024Quote: ... and the DNA adaptor was added for cDNA adaptor ligation using CircLigase™ II ssDNA Ligase (CL9021K, Lucigen) as described by the product instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Only cytoplasmic RNA was treated with the Ribo-Zero Magnetic Gold Kit for human/mouse/Rat (Epicentre) to remove ribosomal RNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5µg of total RNA was subjected to rRNA depletion using the RiboZero Human/Mouse/Rat kit (Epicentre Biotechnologies). cDNA was generated from the depleted RNA using random hexamers or custom primers and Superscript III (Life Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was depleted of ribosomal RNA using Ribo-Zero rRNA Removal Kit (Epicentre/Illumina, Human/Mouse/Rat) and library preparation was completed using NEBNext® Ultra Directional RNA Library Prep Kit for Illumina® (New England Biolabs) ...
-
bioRxiv - Biochemistry 2020Quote: ... 124 nt oligonucleotides (IDT) (see Supplementary Table S7) were circularized using with CircLigase™ single stranded (ss) DNA Ligase (Lucigen) according the manufacturers suggestion ...
-
bioRxiv - Molecular Biology 2020Quote: ... Truncated cDNAs (120-170nt) were size selected from denaturing polyacrylamide gels and gel purified cDNAs were circularized with CircLigase ssDNA ligase (Epicentre). Circularized cDNAs were PCR amplified with forward primer (AATGATACGGCGACCACCGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA was subjected to ribosomal RNA depletion using the Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat; Epicentre), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... the ligase-treated DNA was incubated with 2 μl (10 U/μl) of Plasmid-Safe ATP-Dependent DNase (Lucigen; Middleton, WI) in 1x reaction buffer (33 mM Tris-acetate ...
-
bioRxiv - Genetics 2020Quote: ... Intramolecular circularization of the DNA was performed with T4 DNA ligase and residual linear DNA was degraded by a cocktail of exonucleases containing Plasmid-Safe ATP-dependent DNase (Lucigen #E3101K), Lambda exonuclease (#M0262 ...