Labshake search
Citations for Lucigen :
1 - 50 of 191 citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... coli 5-alpha Chemically Competent cells (Lucigen), performing a thermal shock for 45 seconds at 42°C followed by 2 minutes on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... cloni 5-alpha (short: E. cloni, Lucigen corporation) for all cloning procedures ...
-
bioRxiv - Biochemistry 2024Quote: ... and TetraCys-tagged LexAPaCTD were amplified from the genomic DNA using primers LexA_Pa.For/Rev and LexA_Pa_CTD_4Cys.For/Rev (Supplementary Table 3) and cloned in pETite C-His Kan vector and pETite N-His SUMO Kan Vector (Lucigen), respectively ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Biochemistry 2023Quote: HI-Control™ BL21(DE3) (Lucigen) cells were transformed with plasmid and single colonies were picked to start overnight cultures in LB medium supplemented with 50 μg/mL kanamycin at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Microbiology 2022Quote: ... Escherichia coli BL21(DE3) Hi-Control (Lucigen) was used as an expression host for heterologous expression of HpuA ...
-
bioRxiv - Molecular Biology 2022Quote: ... The amplified products and the linearized N-his pETite vector were transformed in HI-Control10G Chemically Competent Cells (Lucigen) and plated on LB plates supplemented with 50 μg/ml kanamycin (Kan) ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... and were cloned into the pETite C-His vector (Lucigen) with a C-terminal hexahistidine tag ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Protein purification was accomplished using the pETite N-His vector (Lucigen). PCR primers were designed to amplify products for BT2807 and BT2808 containing all amino acids downstream of the predicted signal peptide sequences ...
-
bioRxiv - Microbiology 2019Quote: ... amplified and transformed into Hi-Control 10G cells according to manufactures protocol (Lucigen, Expresso™ T7 cloning and expression system) ...
-
bioRxiv - Cell Biology 2023Quote: ... and His-SUMO-N was inserted into the backbone of pETite-HisSUMO (Lucigen) using NEBuilder HiFi DNA Assembly Master Mix kit (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of RNA was treated with a beta version of Ribo-Zero Magnetic Gold Kit Yeast (Epicentre) to deplete rRNAs ...
-
bioRxiv - Microbiology 2021Quote: ... The ssDNA linker containing a 5′ phosphate and 3′ C3 spacer was ligated to the synthesized cDNA using 20 U of the Circligase I (Lucigen, Middleton, WI). The resultant cDNA was amplified by an adapter-based PCR using the KAPA HiFi DNA polymerase (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... was resuspended in TE and introduced into BL21(DE3) Hi-Control chemically competent cells (Lucigen), which were selected on LB plates supplemented with kanamycin.
-
bioRxiv - Microbiology 2021Quote: ... 5’PPP structures were then converted into 5’P ends using RNA 5’ Polyphosphatase (5’PP, Epicentre), to which RNA adapters were ligated ...
-
bioRxiv - Plant Biology 2019Quote: Each ARF DBD was cloned in the pETite N-His SUMO Kan expression vector (Lucigen, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Purified PCR products were ligated into the pETite vector containing an N-terminal His6 tag (Lucigen) and transformed into HI-Control 10G cells ...
-
bioRxiv - Plant Biology 2024Quote: ... The CDS encoding FLVA (residues 55-723) was cloned into pETite® C-His Kan Vector (Lucigen) downstream of a sequence for a Strep-tag II (WSHPQFEK ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-deadenylase (Epicentre) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Microbiology 2024Quote: ... the 5’PPP structures were removed using RNA 5’ polyphosphatase (Epicentre). Afterwards ...
-
bioRxiv - Plant Biology 2023Quote: ... a modified PET32a vector with an N-terminal His6-SUMO expression tag and SUMO protease cleavage site (Lucigen Corporation). SALTY fusion was expressed in Codon+ BL21 (DE3 ...
-
bioRxiv - Immunology 2019Quote: 1ug of total cellular RNA was treated with RNA 5’ polyphosphatase (enzyme that converts 5’-triphosphorylated RNA into 5’-monophosphorylated RNA, Lucigen) for 30 min at 37°C or mock-treated ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were polyA-tailed and 5’-PPP-ends were trimmed to 5’-P-ends via RNA 5’-polyphosphatase (Epicentre). First-strand cDNA synthesis was performed using an oligo(dT)-adapter and M-MLV reverse transcriptase followed by high-fidelity PCR amplification of the cDNA using primers suitable for Illumina TruSeq sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µg RNA was incubated with 5 U RNase R (#RNR07250; Epicentre) in 1× RNase R buffer (#RNR07250 ...
-
bioRxiv - Microbiology 2023Quote: ... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
bioRxiv - Molecular Biology 2022Quote: ... bromii strain L2-63 and the constructs for Sas6 without the signal peptide were amplified using the primers listed in Table S1 with overhangs complementary to the Expresso T7 Cloning & Expression System N-His pETite vector (Lucigen). The forward primers were engineered to include the 6x His sequence that complemented the vector plus a TEV protease recognition site for later tag removal ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-deadenylase (Epicentre, DA11101K) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Microbiology 2021Quote: ... sequences were designed to remove N-terminal signaling peptides and to add a histidine tag for immobilized metal affinity chromatography (IMAC) (in many cases using the Lucigen MA101-Expresso-T7-Cloning-&-Expression-System) ...
-
bioRxiv - Microbiology 2023Quote: ... Successful RppH treatment was verified by incubating 100 ng of 5’P or 5’PPP transcripts with 20 U RiboLock and 1 U Terminator™ 5’Phosphate-Dependent Exonuclease (Lucigen) in 1x TEX Buffer B for 30 min at 42°C ...
-
bioRxiv - Microbiology 2024Quote: ... the amplified DNA was cloned into the pETite N-His vector (Expresso™ T7 cloning and expression system, Lucigen, # 49001-1), resulting in constructs with an N-terminal 6x His tag ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg of total RNA was treated with the RNA processing enzyme RNA 5′-polyphosphatase (Epicentre) to convert 5′-triphosphate RNA or 5′-diphosphorylated RNA to 5′-monophosphate RNA without dephosphorylating monophosphorylated RNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 U RecJ exonuclease (Epicentre). Up to 8 libraries were pooled ...
-
A conserved isoleucine in the binding pocket of RIG-I controls immune tolerance to mitochondrial RNAbioRxiv - Immunology 2022Quote: RNA 5’Polyphosphatase (Lucigen, Middleton, USA) was used to generate 5’p-RNA from IVT 5’ppp-RNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µl RNase R mixture (Epicentre) was added to the sample before incubation at 37°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 5 U Baseline-ZERO DNase (Epicentre), 25 U Benzonase (Sigma Aldrich) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μl of RNase inhibitor (Lucigen) and 450 μl of IP buffer (150 mM NaCl ...
-
bioRxiv - Genetics 2024Quote: ... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... Library #3 was amplified using pyrophage polymerase (Lucigen, Middleton, WI).
-
bioRxiv - Molecular Biology 2023Quote: ... and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen). Between 50 and 75 ng were retrotranscribed in cDNA with 1.5 µL of template-switching TGIRT enzyme ...
-
bioRxiv - Microbiology 2020Quote: ... the RNA fragments were poly(A)-tailed and 5’PPP structures were removed with RNA 5’ Polyphosphatase (Epicentre). The RNA sequencing adapter with the barcodes were ligated to the 5’-monophosphate of the fragments ...
-
bioRxiv - Molecular Biology 2019Quote: ... rRNA was depleted using the Ribo-Zero kit Human/Mouse/Rat (Epicentre), and libraries were prepared using random priming ...