Labshake search
Citations for Lucigen :
1 - 17 of 17 citations for Hepatitis B Virus E Antigen HBeAg since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (E cloni, Lucigen) for secondary screening ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 7.5 µL Failsafe Premix E (Epicentre), 1.2 µL each of F and R primers (IDT) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G); post-heat shock recovery time was limited to 15-20 minutes to avoid cell division during recovery and ensure that each resulting colony was the result of an independent transformation event ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G). Around 800 thousand colonies were recovered ...
-
bioRxiv - Biochemistry 2022Quote: ... coli cells (E. cloni 10G Elite, Lucigen, USA). Further details on the microfluidic screening can be found in the Supplementary Information.
-
bioRxiv - Cell Biology 2021Quote: ... cloni 5-alpha (short: E. cloni, Lucigen corporation) for all cloning procedures ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified virus RNA was treated with 5 units of tobacco acid pyrophosphatase (Epicentre) to generate 5’ monophosphorylated termini ...
-
bioRxiv - Genomics 2020Quote: ... using a Gibson assembly master mix (New England Biolabs).Gibson assembly products were transformed into electrocompetent cells (E. cloni, Lucigen) and plated on 245mm x 245mm square LB-agar plates to obtain the sufficient number of bacterial colonies at a ∼50× library coverage ...
-
bioRxiv - Genetics 2022Quote: ... single BFU-E and CFU-GM were lysed with QuickExtract Lysis Buffer (Epicentre). CFCs were incubated at 65°C for 20 min followed by an incubation at 98°C for 10 min and centrifuged at 13000 rpm for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: The NDM libraries are then transformed into Escherichia coli (E. cloni 10G, Lucigen) and stored as glycerol stocks ...
-
bioRxiv - Biochemistry 2023Quote: ... the library was electroporated into Escherichia coli cells (E. cloni 10G Elite; Lucigen, USA), yielding ≈ 107 colonies after overnight incubation on agar plates ...
-
bioRxiv - Microbiology 2021Quote: ... The reconstructed product OmRV-fragment1/pACYC177 was then transformed into 10G chemically competent cells (Lucigen, E. cloni), propagated for plasmid purification with the aforementioned method ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Microbiology 2021Quote: ... OmRV-fragment2/pMA (ampicillin resistant) and pACYC177 low-copy-number plasmids were transformed into 10G chemically competent cells (Lucigen, E. cloni), respectively ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... and primers outlined in Table S1. E. coli colony PCRs (Fig. 1F and Fig. S1F- H) were performed with CloneID 1X Colony PCR Mix (Lucigen 30059-2) and primers outlined in Table S1.
-
bioRxiv - Genomics 2022Quote: ... and patients A and B healthy and cancer tissue RNAs (500 ng) were incubated with 20 U exonuclease I (Lucigen) and 2 U Baseline-ZERO DNase (Lucigen ...
-
bioRxiv - Synthetic Biology 2022Quote: ... two ncRNA expression cassettes (for barcoded ncRNAs “A” and “B”) from the Marionette plasmids were cloned into pSol-TSF (Lucigen F843213-1) facing in opposite directions ...