Labshake search
Citations for Lucigen :
1 - 50 of 61 citations for E3 Ubiquitin Protein Ligase RNF128 RNF128 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Ligase I (Lucigen) at 68°C for 2 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... circularized with Circ Ligase (Lucigen), and PCR amplified ...
-
bioRxiv - Microbiology 2021Quote: ... Circ Ligase (Epicentre, cat. No. CL4111K), NEBNext® High-Fidelity 2X PCR Master Mix (cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... circularized by CircLigase™ II ssDNA ligase (Lucigen). Subsequently ...
-
bioRxiv - Genetics 2023Quote: ... 4 units of Ampligase® DNA Ligase (Epicentre), 0.2 ul of Ampligase® 10X Reaction Buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Illumina adapters were ligated using Circ Ligase I (Lucigen) and linker pA-Adapt-Bp (Table S5) ...
-
bioRxiv - Genomics 2022Quote: ... 1x Ampligase DNA ligase buffer (Epicentre Technologies, Madison, WI), 0.5 μl of 5M Betain (Sigma Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... 1µl Fast-Link DNA ligase (Lucigen, cat. no. LK6201H), 3 µl 10× Fast link ligation buffer and 1mM ATP ...
-
bioRxiv - Systems Biology 2023Quote: ... and self-ligated using Fast-link ligase (LK0750H; Lucigen). Duplets of 800bp-1000bp were excised from agarose gel ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNAs were circularized using 100U CircLigase I ssDNA ligase (Epicentre), and cDNA concentration was quantified by QPCR of cDNA compared to a standard curve of a reference sample ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of Fast-Link DNA ligase (Lucigen, cat#LK0750H), and milliQ water up to 15 μl total volume ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was circularized with 100 U CircLigase ssDNA Ligase (Lucigen) in the presence of 1X CircLigase Buffer ...
-
bioRxiv - Microbiology 2021Quote: Purified cDNA was subject to circularization via CircLigase ssDNA Ligase (Lucigen) per the manufacturer’s specifications ...
-
bioRxiv - Genomics 2021Quote: ... 1.5 μl ATP and 1 μl FastLink DNA ligase (Lucigen Corporation), followed by heat inactivation for 15 min at 70°C ...
-
bioRxiv - Genetics 2021Quote: ... The remainder was self-ligated using Fast-link ligase (LK0750H; Lucigen), after which duplets of ~800bp were excised from agarose gel and purified (BIO-52059 ...
-
bioRxiv - Microbiology 2020Quote: The resulting cDNA was circularized by 40 U ssDNA ligase (Lucigen) at 60 °C for 4 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... The purified cDNA was then circularized using CircLigaseII ssDNA ligase (Epicentre) for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genomics 2023Quote: ... 0.2 µl of Fast-Link DNA Ligase (Lucigen, cat. no. LK6201H), 1.2 mM ATP ...
-
bioRxiv - Immunology 2023Quote: ... Circular ligation was performed using CircLigase II ssDNA Ligase (Epicentre CL4111K) for 1,5 hours at 60°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted cDNA was circularized with CircLigase II ssDNA ligase (Lucigen, CL9021K) for 1 hr at 60°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cDNA was circularized by CircLigase™ II ssDNA Ligase (Epicentre, CL9025K). Next ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 μl of 2.5 U of CircLigase II ssDNA Ligase (Lucigen), and incubating the resultant mixtures at 40°C for 3 h ...
-
bioRxiv - Bioengineering 2023Quote: ... Ampligase DNA Ligase and 10X Reaction Buffer were purchased from Lucigen (A3202K). 2X GoTaq G2 Hot Start Colorless Master Mix was purchased from Promega (9IM743) ...
-
bioRxiv - Biochemistry 2024Quote: ... The resulting cDNA products were circularized with CircLigase ssDNA ligase (Lucigen, USA). Illumina sequencing adaptors were introduced by PCR and the final library sequenced at the JHU Genetic Resources Core Facility on a HiSeq2500 (Illumina ...
-
bioRxiv - Synthetic Biology 2019Quote: ... ssDNA adapter ligation was performed using the CircLigase ssDNA ligase kit (#CL4115K, Epicentre). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was circularized using T4 RNA ligase 1 (Epicentre or New England BioLabs) and reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli genomic DNA in 15 μL of 1× Ampligase DNA Ligase Buffer (Epicentre) containing 250 ng of unshared E ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4μL 50mM MnCl2 and 0.3μL of 100U/μl CicrLigase II ssDNA ligase (Epicentre CL9021K) and incubated in a PCR machine at 60°C for 60 minutes ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... The size-selected and purified cDNA was circularized using CircLigase ssDNA ligase kit (Lucigen) following manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10pmol of template oligo was cyclized and ligated using CircLigase II ssDNA Ligase (Lucigen) supplemented with 2.5mM MnCl2 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Ampligase Thermostable DNA Ligase for LCR reaction was obtained from Lucigen (Middleton, USA).
-
bioRxiv - Synthetic Biology 2022Quote: ... and 1.5 μL of 5 U μL-1 Ampligase Thermostable DNA Ligase (Lucigen, USA). Water was added to a total volume of 25 μL ...
-
bioRxiv - Systems Biology 2024Quote: ... The reaction was performed overnight at 37℃ using 1x Ampligase ligase buffer (Lucigen, A1905B), 50 mM KCl (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reverse-transcribed products were then gel-purified and circularized using CircLigase ssDNA Ligase (Epicentre), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Free mRNA and rRNA ends were then ligated into circular forms with a circRNA ligase (Lucigen); it favors ligation events between proximal RNA ends11 and it has limited activity at high temperature ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... recovered and used for the 20 µL circularization reaction (100 U CircLigase™ ssDNA Ligase (Lucigen, CL4111K), 50 mM ATP ...
-
bioRxiv - Microbiology 2024Quote: ... and the DNA adaptor was added for cDNA adaptor ligation using CircLigase™ II ssDNA Ligase (CL9021K, Lucigen) as described by the product instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 124 nt oligonucleotides (IDT) (see Supplementary Table S7) were circularized using with CircLigase™ single stranded (ss) DNA Ligase (Lucigen) according the manufacturers suggestion ...
-
bioRxiv - Molecular Biology 2020Quote: ... Truncated cDNAs (120-170nt) were size selected from denaturing polyacrylamide gels and gel purified cDNAs were circularized with CircLigase ssDNA ligase (Epicentre). Circularized cDNAs were PCR amplified with forward primer (AATGATACGGCGACCACCGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Genomics 2020Quote: ... the ligase-treated DNA was incubated with 2 μl (10 U/μl) of Plasmid-Safe ATP-Dependent DNase (Lucigen; Middleton, WI) in 1x reaction buffer (33 mM Tris-acetate ...
-
bioRxiv - Genetics 2020Quote: ... Intramolecular circularization of the DNA was performed with T4 DNA ligase and residual linear DNA was degraded by a cocktail of exonucleases containing Plasmid-Safe ATP-dependent DNase (Lucigen #E3101K), Lambda exonuclease (#M0262 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the recovered cDNA was circularized by incubation in a reaction volume of 10 μl in the presence of 50 U CircLigase™ ssDNA Ligase (Epicentre), 1 M betaine ...
-
bioRxiv - Microbiology 2022Quote: ... Protein precipitation reagent (Lucigen) was added and samples were spun at maximum speed ...
-
bioRxiv - Genomics 2023Quote: ... About 20,000 prepared barcode beads were resuspended in 40 μl enzyme buffer (1 U/μl Fast-Link DNA Ligase (Lucigen, E0077-2-D3), 20% End-It Enzyme Mix (Lucigen ...
-
bioRxiv - Developmental Biology 2023Quote: ... the 3′ ends of small RNA were ligated to an adapter using T4 truncated RNA ligase (Lucigen, Cat# LR2D11310K and NEB, Cat# M0242L), followed by the ligation of the 5′-end adaptors by T4 ligase ...
-
bioRxiv - Biochemistry 2020Quote: ... Mutant proteins were expressed in strain C41 (Lucigen) by induction at mid-log phase (OD600 ∼0.4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Wild-type proteins were expressed in strain C41 (Lucigen) by induction at mid-log phase (OD600∼0.4 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli (C41) cells for protein expression were purchased from Lucigen Corporation (Wisconsin) ...
-
bioRxiv - Microbiology 2019Quote: ... Protein purification was accomplished using the pETite N-His vector (Lucigen). PCR primers were designed to amplify products for BT2807 and BT2808 containing all amino acids downstream of the predicted signal peptide sequences ...