Labshake search
Citations for Lucigen :
1 - 50 of 59 citations for Dengue Virus serotype 3 lysate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates containing 3 μg of total RNA were treated with 20 U of RNase I (Lucigen) for 45[min at 25°C and then subjected to a sucrose cushion ultracentrifugation at 100,000[rpm for 1[h at 4°C with Optima MAX-TL ultracentrifuge and TLA-110 rotor (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lysate was digested with RNase I (Lucigen) before ribosomes were isolated through ultracentrifugation through a sucrose cushion ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified virus RNA was treated with 5 units of tobacco acid pyrophosphatase (Epicentre) to generate 5’ monophosphorylated termini ...
-
bioRxiv - Genetics 2020Quote: ... Worms were lysed in DNA Quick Lysate (Epicentre Technologies) for 1 hour at 60°C and the lysate was then used as a template for PCR with Q5 Hot Start High-Fidelity DNA Polymerase (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were treated with 500 U of RNAse I (Epicentre) per 25 μg of RNA (quantified by Qubit fluorimetry – ThermoFisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell lysates were prepared using the EasyLyseTM bacterial protein extract solution (Lucigen Corp. USA) or the CelLytic B reagent (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell lysates were prepared using the EasyLyseTM bacterial protein extract solution (Lucigen Corp. USA) or the CelLytic B reagent (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell lysates containing 10 μg of total RNA were subjected to RNase I (Lucigen) treatment for 45 min at 25°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The lysate containing 10 µg RNA was treated with 20 U of RNase I (Lucigen) for 45 min at 25ºC ...
-
bioRxiv - Molecular Biology 2023Quote: ... We treated cell lysate containing 8.5 µg total RNA with 20 U RNase I (Epicentre) in a 300 µl reaction at 25°C for 45 min ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Molecular Biology 2022Quote: ... the lysates containing 10 µg of total RNA were treated with 2 U/µg RNase I (Lucigen) at 25°C for 45 min ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Systems Biology 2023Quote: ... Lysate containing 20 µg of total RNA was digested with 10 U of RNase I (Lucigen, WI, USA) for 45 min at 25°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Whole cell lysates containing 10 µg of total RNA were each treated with 12.5 units of RNase I (Epicentre) at 23°C for 45 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... whole cell lysates containing 20 µg of total RNA were each treated with 10 units of RNase I (Epicentre) at 24°C for 45 min ...
-
bioRxiv - Systems Biology 2020Quote: ... RNA digestion of lysates was performed for 1 hour with the mixture of 2000 Units of RNase T1 (Epicentre) and 300 Units of RNase S7 (Roche/Sigma) ...
-
bioRxiv - Genomics 2019Quote: ... Library #3 was amplified using pyrophage polymerase (Lucigen, Middleton, WI).
-
bioRxiv - Molecular Biology 2023Quote: ... and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen). Between 50 and 75 ng were retrotranscribed in cDNA with 1.5 µL of template-switching TGIRT enzyme ...
-
bioRxiv - Microbiology 2021Quote: ... from lysate of the filamentous bacterial fraction acquired by incubation for 8 hours with 10 U/µl Ready-lyse lysozyme (Epicentre). The sequencing library was prepared using the Nextera XT kit and sequenced the same way as for the SAGs.
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Neuroscience 2019Quote: The RNA isolated from each cell was reverse transcribed and amplified using T7 linear amplification (Epicentre, MessageBOOSTER kit for cell lysate), run through RNA Cleaner & Concentrator-5 columns (Zymo Research) ...
-
bioRxiv - Neuroscience 2020Quote: ... the RNA collected from each cell was reverse transcribed and amplified using T7 linear amplification (Epicentre, MessageBOOSTER kit for cell lysate), cleaned with RNA Cleaner & Concentrator-5 columns (Zymo Research) ...
-
bioRxiv - Neuroscience 2020Quote: The RNA isolated from each cell was reverse transcribed and amplified using T7 linear amplification (Epicentre, Message BOOSTER kit for cell lysate), run through RNA Cleaner & Concentrator-5 columns (Zymo Research) ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to tubes containing 3 μL of lysis buffer (Epicentre, MessageBOOSTER kit). Cells were collected within 1 h of removal from the incubator and within 4 h of removal from the animals.
-
bioRxiv - Biochemistry 2019Quote: ... the dissolved cDNA was mixed with 3 μl of 10x CircLigase Buffer (Epicentre), 1.5 μl of 50 mM MnCl2 ...
-
bioRxiv - Plant Biology 2022Quote: ... It was then proceeded using RNase R (3 U/μg; Epicentre, Madison, USA) at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3) Remaining linear DNA was removed by exonuclease (Plasmid-Safe ATP-dependent DNase, Epicentre), assisted by rare-cutting endonuclease MssI (only support Homo sapiens ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were collected after 3 days and lysed with QuickExtract DNA Extraction Solution (Lucigen): endogenous loci were PCR amplified with HOT FIREPol MultiPlex Mix (Solis BioDyne) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the Quantseq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 60 ug total RNA per sample was incubated with 3 uL RNase I (Epicentre #N6901K) for 45 minutes at RT with light shaking ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2020Quote: Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Neuroscience 2019Quote: ... a 3-axis micromanipulator with borosilicate glass electrodes was used to pick up cells into 3µL of lysis buffer (Epicentre, MessageBOOSTER), their ROI identifier was recorded ...
-
bioRxiv - Genomics 2020Quote: ... Multiple PCR reactions for each sample were carried out with 200 pg of annealed DNA using the XpYpE2 and teltail primers (Supplementary Table 3) and FailSafe PCR reagents (Epicentre). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ ends of the restricted and CPD-incised DNA fragments were ligated to Illumina sequencing adapters by using Circligase (Lucigen). After PCR amplification ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was prepared from 3 mL of turbid liquid culture with the MasterPureTM Gram Positive DNA Purification Kit (Lucigen). DNA was quantified by using a NanodropTM device (Thermo Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and TetraCys-tagged LexAPaCTD were amplified from the genomic DNA using primers LexA_Pa.For/Rev and LexA_Pa_CTD_4Cys.For/Rev (Supplementary Table 3) and cloned in pETite C-His Kan vector and pETite N-His SUMO Kan Vector (Lucigen), respectively ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...