Labshake search
Citations for Lucigen :
1 - 50 of 796 citations for Cow Prostaglandin E Synthase 2 PTGES2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (E cloni, Lucigen) for secondary screening ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 7.5 µL Failsafe Premix E (Epicentre), 1.2 µL each of F and R primers (IDT) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G); post-heat shock recovery time was limited to 15-20 minutes to avoid cell division during recovery and ensure that each resulting colony was the result of an independent transformation event ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G). Around 800 thousand colonies were recovered ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... and primers outlined in Table S1. E. coli colony PCRs (Fig. 1F and Fig. S1F- H) were performed with CloneID 1X Colony PCR Mix (Lucigen 30059-2) and primers outlined in Table S1.
-
bioRxiv - Biochemistry 2022Quote: ... coli cells (E. cloni 10G Elite, Lucigen, USA). Further details on the microfluidic screening can be found in the Supplementary Information.
-
bioRxiv - Cell Biology 2021Quote: ... cloni 5-alpha (short: E. cloni, Lucigen corporation) for all cloning procedures ...
-
bioRxiv - Bioengineering 2020Quote: ... 2’-fluoro (2’-F) modified RNA was synthesized using the DuraScribe T7 transcription kit (Lucigen) as described in the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... NxSeq DNA sample prep kit 2 (Lucigen, Middleton, WI, USA) was used as per manufacturer’s directions with either NEXTFlex 48 barcodes (BioO ...
-
bioRxiv - Genomics 2020Quote: ... using a Gibson assembly master mix (New England Biolabs).Gibson assembly products were transformed into electrocompetent cells (E. cloni, Lucigen) and plated on 245mm x 245mm square LB-agar plates to obtain the sufficient number of bacterial colonies at a ∼50× library coverage ...
-
bioRxiv - Genetics 2022Quote: ... single BFU-E and CFU-GM were lysed with QuickExtract Lysis Buffer (Epicentre). CFCs were incubated at 65°C for 20 min followed by an incubation at 98°C for 10 min and centrifuged at 13000 rpm for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: The NDM libraries are then transformed into Escherichia coli (E. cloni 10G, Lucigen) and stored as glycerol stocks ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was amplified (Epicenter TargetAmp 2-Round aRNA Amplification Kit 2.0, Epicentre Biotechnologies), DNase-treated (RapidOut DNA Removal kit ...
-
bioRxiv - Neuroscience 2023Quote: ... transposable element insertional mutagenesis using EZ-Tn5™
2> Insertion Kit (Epicentre) and sequencing were performed ... -
bioRxiv - Biochemistry 2023Quote: ... the library was electroporated into Escherichia coli cells (E. cloni 10G Elite; Lucigen, USA), yielding ≈ 107 colonies after overnight incubation on agar plates ...
-
bioRxiv - Bioengineering 2022Quote: 2’-Fluoro ssRNA was produced by IVT using the Durascribe T7 IVT kit (Epicentre). Reactions consisted of 0.2-1 μg of purified DNA template per 20 μl reaction ...
-
bioRxiv - Genomics 2019Quote: ... genomic DNA samples (∼2 µg) were end-repaired using the End-it kit from Epicentre Technologies (Madison ...
-
bioRxiv - Microbiology 2020Quote: Random knockout mutants were produced using the EZ::Tn5Tm
2> Tnp TransposomeTm kit (Epicentre) following the manufacturers recommendations ... -
bioRxiv - Molecular Biology 2020Quote: Transposon mutant libraries were constructed using the EZ-Tn5
2>TnP Transposome Kit (Epicentre) according to the manufacturer’s instructions ... -
bioRxiv - Microbiology 2022Quote: ... Enteritidis strains P125109 and D7795 using the EZ-Tn5™
2> Insertion Kit (Lucigen) as previously described [31] ... -
bioRxiv - Molecular Biology 2023Quote: ... we utilized the ScriptCap m7G Capping System and ScriptCap 2’-O-methyltransferase kit (Epicentre Biotechnologies) with [α-32P] GTP for our experiments ...
-
bioRxiv - Plant Biology 2021Quote: ... and in vitro amplified using a TargetAmp 2-round aRNA Amplification Kit 2.0 (Epicentre, Madison, WI). RNA-seq libraries were constructed using a TruSeq Stranded mRNA Library Prep Kit and quantified on an Agilent bioanalyzer (Agilent ...
-
bioRxiv - Microbiology 2023Quote: Transposon library of Salmonella was generated using EZ-Tn5
2>Tnp Transposome kit (Lucigen, TSM99K2) following manufacturer’s instructions ... -
bioRxiv - Microbiology 2024Quote: A transposon mutant library in pJBG007 was made using EZ-Tn5
2> Insertion Kit (Lucigen). The following components were used for a 10µl reaction (EZ-Tn5 10X Reaction Buffer (1µl ... -
bioRxiv - Microbiology 2021Quote: ... The reconstructed product OmRV-fragment1/pACYC177 was then transformed into 10G chemically competent cells (Lucigen, E. cloni), propagated for plasmid purification with the aforementioned method ...
-
bioRxiv - Cell Biology 2020Quote: ... maltophilia transposon insertion mutant library was constructed using an EZ::TN
2> Tnp transposome kit (Epicentre) as described previously and in accordance with the manufacturer’s protocol (Weisenfeld ... -
bioRxiv - Microbiology 2020Quote: ATCC 17978 transposon mutants were generated using the EZ-Tn5™
2> Insertion Kit (Epicentre Biotechnologies) as previously described [33] ... -
bioRxiv - Synthetic Biology 2022Quote: ... DNA of 2 mL overnight culture was extracted with the MasterPure™ Yeast DNA Purification Kit (Lucigen) and whole PCR Tag analysis was performed on population level to test the general presence of all tRNAs within the population (data not shown) ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon mutagenesis was performed with the EZ-Tn5
2>Tnp Transposome kit (Epicentre, Illumina, CA, USA) and the insertion site of all mutants was determined via arbitrary PCR (Segev et al ... -
bioRxiv - Genomics 2020Quote: Libraries were prepared from the DNA samples using the NxSeq AmpFREE Low DNA Library kit (Lucigen, Cat no. 14000-2) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... was used to create a fusion PCR product to replace fHbp in strain L91543 with the kanamycin resistance gene (kan) from EZ::Tn5
2> insertion kit (Epicentre) following the approach described by Horton [57] ... -
bioRxiv - Molecular Biology 2020Quote: ... A library of ∼500,000 independent mini-Tn5 transposon mutants was created by transforming BW25113 ΔascA with an EZ-Tn5
2> Tnp transposome kit (Epicentre) by electroporation ... -
bioRxiv - Immunology 2019Quote: ... The DNase-treated RNA (2 μg) was treated with Ribo-Zero using an Epicentre Ribo-Zero Gold Kit (Human/Rat/Mouse) (Epicentre) and re-purified on Ampure XP beads.
-
bioRxiv - Microbiology 2023Quote: ... These electrocompetent cells were transformed with the transposon Tn5::kan (EZ-Tn5™
2>Tnp Transposome™ Kit, Lucigen) following the indications of the manufacture ... -
bioRxiv - Synthetic Biology 2023Quote: ... was constructed from the linear pSMART-HCKan vector supplied in the Lucigen CloneSmart kit (Lucigen, Middleton WI, Cat#40708-2) with a single ligation step ...
-
bioRxiv - Microbiology 2023Quote: Random mutant libraries of En-Cren bacteria were generated by electroporation with the EZ-Tn5
2> Tnp Transposome Kit (Lucigen) and stored in 20% glycerol at -80 °C for future use in the fungal hyphae movement mutant screening ... -
bioRxiv - Microbiology 2021Quote: ... OmRV-fragment2/pMA (ampicillin resistant) and pACYC177 low-copy-number plasmids were transformed into 10G chemically competent cells (Lucigen, E. cloni), respectively ...
-
bioRxiv - Plant Biology 2022Quote: ... The first strand of cDNA was synthesized from total RNA (2 μg) using the NxGen M-MuLV Reverse Transcriptase cDNA synthesis kit (Lucigen, UK). The qPCR consisted of a final volume of 15 μl containing 10 ng of cDNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: A transposon mutant library for the WT strain was generated by electroporation using the EZ-Tn5
2> Tnp transposome kit (Lucigen Inc.). The library consisted of approximately 40,000 insertion mutants ... -
bioRxiv - Genetics 2021Quote: ... coli (Lucigen, 60242-2) by electroporation (1.8 kV ...
-
bioRxiv - Neuroscience 2022Quote: ... coli (Lucigen 60242-2) using program EC1 on MicroPulser Electroporator (Bio-Rad 1652100 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 uL of eluent was then electroporated into each of 2 tubes of 50 uL Endura electrocompetent cells (Lucigen, Cat#60242-2) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and a mix of 600 µl of tissue and cell lysis solution and 2 µl Proteinase K from the MasterPure Complete DNA and RNA Purification Kit (Epicentre-Lucigen, Middleton, WI) was added to each sample tube ...
-
bioRxiv - Biophysics 2020Quote: ... pSMART_ptsG-10aa-sfGFP (“10aa” refers to the first 10 codons) was generated from pZEMB8 (19) using site directed mutagenesis and the pSMART LCKan Blunt Cloning Kit (Lucigen, 40821-2). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... and the kanamycin resistance gene (KanR) of the transposon of the EZ-Tn5™
2> Insertion Kit (Lucigen, Wisconsin, USA) via overlap extension PCR by using primers list in Supplementary Table3 ... -
bioRxiv - Cancer Biology 2019Quote: ... coli (Lucigen, cat. 60242-2) using Bio-Rad MicroPulser Electroporator (cat ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Step 2: Riboshredder RNase (Epicentre) was used in place of RNase A ...
-
bioRxiv - Immunology 2020Quote: ... coli (Lucigen, Cat# 60502-2) over fifty shocks for each library ...
-
bioRxiv - Microbiology 2024Quote: ... 2 (Lucigen, Middleton, WI, USA) according to the manufacturer’s instructions ...