Labshake search
Citations for Lucigen :
1 - 50 of 194 citations for 6H Pyrrolo 3 2 e benzothiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (E cloni, Lucigen) for secondary screening ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 7.5 µL Failsafe Premix E (Epicentre), 1.2 µL each of F and R primers (IDT) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G); post-heat shock recovery time was limited to 15-20 minutes to avoid cell division during recovery and ensure that each resulting colony was the result of an independent transformation event ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G). Around 800 thousand colonies were recovered ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... and primers outlined in Table S1. E. coli colony PCRs (Fig. 1F and Fig. S1F- H) were performed with CloneID 1X Colony PCR Mix (Lucigen 30059-2) and primers outlined in Table S1.
-
bioRxiv - Biochemistry 2022Quote: ... coli cells (E. cloni 10G Elite, Lucigen, USA). Further details on the microfluidic screening can be found in the Supplementary Information.
-
bioRxiv - Cell Biology 2021Quote: ... cloni 5-alpha (short: E. cloni, Lucigen corporation) for all cloning procedures ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Genomics 2020Quote: ... using a Gibson assembly master mix (New England Biolabs).Gibson assembly products were transformed into electrocompetent cells (E. cloni, Lucigen) and plated on 245mm x 245mm square LB-agar plates to obtain the sufficient number of bacterial colonies at a ∼50× library coverage ...
-
bioRxiv - Genetics 2022Quote: ... single BFU-E and CFU-GM were lysed with QuickExtract Lysis Buffer (Epicentre). CFCs were incubated at 65°C for 20 min followed by an incubation at 98°C for 10 min and centrifuged at 13000 rpm for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: The NDM libraries are then transformed into Escherichia coli (E. cloni 10G, Lucigen) and stored as glycerol stocks ...
-
bioRxiv - Biochemistry 2022Quote: ... the genes encoding the three isoforms of hnRNPDL (hnRNPDL-1, hnRNPDL-2 and hnRNPDL-3) were inserted into pETite (Lucigen corporation) vector with a His-SUMO N-terminal tag ...
-
bioRxiv - Biochemistry 2023Quote: ... the library was electroporated into Escherichia coli cells (E. cloni 10G Elite; Lucigen, USA), yielding ≈ 107 colonies after overnight incubation on agar plates ...
-
bioRxiv - Microbiology 2021Quote: ... The reconstructed product OmRV-fragment1/pACYC177 was then transformed into 10G chemically competent cells (Lucigen, E. cloni), propagated for plasmid purification with the aforementioned method ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Microbiology 2021Quote: ... OmRV-fragment2/pMA (ampicillin resistant) and pACYC177 low-copy-number plasmids were transformed into 10G chemically competent cells (Lucigen, E. cloni), respectively ...
-
bioRxiv - Genetics 2021Quote: ... coli (Lucigen, 60242-2) by electroporation (1.8 kV ...
-
bioRxiv - Neuroscience 2022Quote: ... coli (Lucigen 60242-2) using program EC1 on MicroPulser Electroporator (Bio-Rad 1652100 ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 uL of eluent was then electroporated into each of 2 tubes of 50 uL Endura electrocompetent cells (Lucigen, Cat#60242-2) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... coli (Lucigen, cat. 60242-2) using Bio-Rad MicroPulser Electroporator (cat ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Step 2: Riboshredder RNase (Epicentre) was used in place of RNase A ...
-
bioRxiv - Immunology 2020Quote: ... coli (Lucigen, Cat# 60502-2) over fifty shocks for each library ...
-
bioRxiv - Microbiology 2024Quote: ... 2 (Lucigen, Middleton, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Library #3 was amplified using pyrophage polymerase (Lucigen, Middleton, WI).
-
bioRxiv - Molecular Biology 2023Quote: ... and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen). Between 50 and 75 ng were retrotranscribed in cDNA with 1.5 µL of template-switching TGIRT enzyme ...
-
bioRxiv - Bioengineering 2020Quote: ... 2’-fluoro (2’-F) modified RNA was synthesized using the DuraScribe T7 transcription kit (Lucigen) as described in the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2019Quote: ... The purified capped RNA was subjected to 2’-O methylation using ScriptCapTM 2’-O-Methyltransferase (Epicentre) in the presence of cold S-adenosyl methionine (SAM ...
-
bioRxiv - Microbiology 2020Quote: ... 2 µl TEX reaction buffer (Lucigen) and 0.5 µl RiboGuard RNase Inhibitor (Lucigen ...
-
bioRxiv - Microbiology 2019Quote: ... 2 μL of EZ-Tn5 (Lucigen) in vitro-assembled transposomes were added to the 50 μL cell suspension in sorbitol before electroporation ...
-
bioRxiv - Genomics 2020Quote: ... 2 mL of recovery buffer (Lucigen) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl Plasmid-Safe Enzyme (Lucigen), and 6 μl 10mM ATP (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl of Thermostable RNAseH (Epicentre) and 8 µl of RNAseH buffer (pH 7.5 ...
-
bioRxiv - Systems Biology 2022Quote: Endura Electrocompetent Cells (Lucigen #60242-2) were thawed on ice for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... v.2 (Lucigen, Middleton, WI, USA) according to the manufacturer’s instructions and quantified with the Qubit 4 fluorometer and the dsDNA HS Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Version 2 (Lucigen, Middelton, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Genomics 2022Quote: ... and 2 U Baseline-ZERO DNase (Lucigen) in Baseline-ZERO DNase Buffer for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 u/µl NxGen RNase inhibitor (Lucigen), 0.1 u/µl vaccinia capping enzyme (VCE ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml/L fosmid autoinduction solution (Epicentre), each plate supplemented with 0.3% (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... coli cells (Lucigen, catalog no. 60242-2) at 50–100 ng/ul ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µL TypeOne Restriction Inhibitor (Lucigen, USA) and 0.4 µL transposome ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to tubes containing 3 μL of lysis buffer (Epicentre, MessageBOOSTER kit). Cells were collected within 1 h of removal from the incubator and within 4 h of removal from the animals.
-
bioRxiv - Biochemistry 2019Quote: ... the dissolved cDNA was mixed with 3 μl of 10x CircLigase Buffer (Epicentre), 1.5 μl of 50 mM MnCl2 ...
-
bioRxiv - Plant Biology 2022Quote: ... It was then proceeded using RNase R (3 U/μg; Epicentre, Madison, USA) at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... 11 μL purified CUT&Tag-DNA was used in the reaction (11 μL DNA, 2 μL 10 μM Tn5mC-ReplO1 oligo, 2 μL 10× Ampligase buffer (Lucigen), 2 μL dNTP mix (2.5mM each ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 ul per tube was transformed into two tubes of 50 ml of Endura electrocompetent cells (Lucigen, Cat#60242-2) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... 2 μl per tube was transformed into two tubes of 50 μl of Endura electrocompetent cells (Lucigen, Cat#60242-2) following the manufacturer’s instructions ...