Labshake search
Citations for Agilent :
1 - 35 of 35 citations for p p' DDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... and rabbit anti-sheep (P-0447, P-0448 and P-0163 DAKO, Denmark).
-
bioRxiv - Physiology 2021Quote: ... ACCβ: P-0397 (DAKO), 259 kDa ...
-
bioRxiv - Bioengineering 2023Quote: ... 4.6 × 300mm (Agilent, P/N: PL1580-5301) SEC column connected to Agilent 1260 Bioinert Infinity Quaternary Pump System (Pump serial# DEAGH00678) ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Molecular Biology 2022Quote: ... aliquots were alkylated with 50 mM PNBM (p-nitrobenzyl mesylate, Agilent) at a final concentration of 2.5 mM for 1 h at RT ...
-
bioRxiv - Neuroscience 2021Quote: ... and the quality of the libraries were performed on a 2100 Bioanalyzer from Agilent using an Agilent High Sensitivity DNA kit (Agilent P/N 5067-4626). Sequencing libraries were loaded at 10 to 12pM on an Illumina HiSeq2500 with 2 × 50 paired-end kits using the following read length ...
-
bioRxiv - Biochemistry 2019Quote: ... followed by addition of 0.5μL of OPA dye (Agilent P/N 5061-3335). Finally ...
-
bioRxiv - Biochemistry 2019Quote: ... 1μL from sample was mixed with 2.5μL of borate buffer (Agilent P/N 5061-3339), followed by addition of 0.5μL of OPA dye (Agilent P/N 5061-3335) ...
-
bioRxiv - Cell Biology 2020Quote: Quantitative reverse transcription PCR (qRT-PCR) analysis was carried out on an MX300-P (Agilent technologies) using gene specific primers (QuantiTect® ...
-
bioRxiv - Microbiology 2019Quote: ... Hybridized arrays were scanned at 5 μm resolution on a Microarray Scanner (Agilent p/n G2565BA). Data extraction from images was done by using Agilent Feature Extraction (FE ...
-
bioRxiv - Physiology 2020Quote: ... samples were analyzed on a Hewlett-Packard (H-P, now Agilent Technologies, Santa Clara CA, USA) 6890 gas chromatograph (GC ...
-
bioRxiv - Biochemistry 2023Quote: ... through integration of extracted ion chromatograms (EIC) corresponding to products (P) and substrates (S) (Agilent ChemStation) and normalized according to equation: Multiple products were observed for Axl substrates Syn A ...
-
bioRxiv - Microbiology 2021Quote: ... The ODBG-P-RVn extracts were analyzed using an Agilent 1200 HPLC system (Agilent, Santa Clara, CA) coupled to an API5500 mass analyzer (SCIEX ...
-
bioRxiv - Microbiology 2020Quote: ... and p-dsbS(S239A)- flag were obtained using the QuikChange II site-directed mutagenesis kit (Stratagene, catalog#: 200518). For generating p-dsbR(D51A)-flag ...
-
bioRxiv - Cancer Biology 2023Quote: ... and MET p.(Cys1125Gly) were created with the QuickChange site-directed mutagenesis system (Agilent Technologies, Santa Clara, CA) on the pRS2 vector encoding wild-type MET cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... p-nitrophenyl acetate (pNPA) hydrolysis was determined using a SpectraMax Plus384 microplate reader (Agilent Technologies, Seoul, Republic of Korea). The cell lysates were transferred to a 96-well plate and reactions (0.2 mL final mixture volume ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation variants found in P.1 and 10-mutation variant (BZΔ10) were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana VSV (rVSV ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was determined during basal and upon addition of oligomycin (1 µM), carbonylcyanide p-(trifluoromethoxy) phenylhydrazone (FCCP, 2 µM) and rotenone/antimycin (0.5 µM) using the Seahorse XFe24 bioanalyzer (Agilent). Data from each well was corrected to cell number using the Bio Tek Cytation 1 Cell Imaging Multimode Reader and presented as mean +/-SEM.
-
bioRxiv - Bioengineering 2023Quote: ... After calibrating and verifying the performance of the column using the LC Bio-standard (Agilent, P/N : 5190-9417), the recombinant antibody samples were diluted to 2mg/ml in 1XPBS and loaded onto a pre-conditioned column at a flow rate of 0.35ml/min ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Biophysics 2021Quote: ... The samples were heated up with a ramp rate of 1 °C/min over a temperature range of 15-95 °C using the qPCR System MX 3005 P (Stratagene). Measurements were performed in triplicate ...
-
bioRxiv - Bioengineering 2022Quote: ... approximately one-million cells were incubated in the FCM buffer with biotinylated ACE2 peptidomimetics (h-deface2 and p-deface2) labeled with Streptavidin-phycoerythrin (SA PE, Prozyme) at the indicated protein concentrations (for one hour at 4°C in the dark ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Then quantification of viral copy numbers was carried out in duplicate by quantitative PCR using a Mx3005 P Thermocycler (Agilent) as described by [49] ...
-
bioRxiv - Physiology 2023Quote: ... The cells were transfected with 100 ng of NF-κB firefly luciferase reporter plasmid p(NF-κB)3-Luc (Stratagene) and 10 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5989-8310EN (Agilent G1676AA Agilent Fiehn GC/MS Metabolomics RTL Library User Guide. June 2008. Agilent P/N: G1676-90000, Agilent Fiehn GC/MS Metabolomics RTL Library Product Note ...
-
bioRxiv - Biochemistry 2023Quote: ... Mutations in the pCEFL-HA-HaloTag-P-Rex1 WT construct were created by QuikChange II site-directed mutagenesis (Agilent 200523). All constructs were confirmed by sequencing and expression was tested by immunoblot.
-
bioRxiv - Cancer Biology 2019Quote: ... for 15 min and subsequently replaced with anti-249T-P pAbs diluted at 1:250 with antibody diluent solution (Agilent Technologies). Slides were incubated at 4°C overnight and then washed and visualized with DAB+ substrate chromogen (Agilent Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... The resulting cDNA (equivalent to 500ng of total RNA) was amplified using the SYBR Green real-time PCR kit and detected on a Stratagene Mx3005 P (Agilent Technologies). qPCR was conducted using forward and reverse primers (sequences available upon request) ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutagenesis was performed on the pGAMA-YAP construct to create p-GAMA-YAP-S127A using the QuikChange Lightning kit (Agilent Technologies #210513). Forward primers used for the Ser-to-Ala substitution was as follows ...
-
bioRxiv - Bioengineering 2020Quote: ... ENVs were collected 3 days after electroporation and analyzed for miR-101-3p content by RT-PCR using the qScript microRNA cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA) and SYBR Mastermix (Quanta Biosciences) on a Stratagene Mx 3000 P (Stratagene, San Diego, CA). The primer for miR-101-3p was (TACAGTACTGTGATAACTGAA) ...
-
bioRxiv - Cell Biology 2022Quote: ... 120 μL of supernatant was removed from each tube and filtered using 0.2 μm polyvinylidene fluoride filter (Agilent Technologies P/N: 203980-100) and collected via 6,000 rcf centrifuge for 4 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... and L325A—were created using plasmids harboring the wild type GNNV-P sequence and a QuickChange Lightning site-directed mutagenesis kit (Agilent Technologies, CA, USA). Mutations were confirmed by PCR sequencing (Genomics Inc. ...
-
bioRxiv - Genomics 2021Quote: ... A mouse monoclonal anti-p63 antibody (1:500, MS-1081-P, Neomarkers, Fremont, CA, USA) and followed by a secondary kit (Mouse Envision, DAKO-Agilent, Santa Clara CA, USA), stained with chromogen (3,3′-Diaminobenzidine [DAB] ...
-
bioRxiv - Microbiology 2021Quote: ... Concentrations of extracellular metabolites and putative alcoholic contaminants of NAD(P)H substrates were analyzed by high-performance liquid chromatography (HPLC) on an Agilent 1100 HPLC (Agilent Technologies, Santa Clara, CA USA) with an Aminex HPX-87H ion-exchange column (BioRad ...
-
bioRxiv - Genomics 2021Quote: ... A mouse monoclonal anti-p63 antibody (1:500, MS-1081-P, Neomarkers, Fremont, CA, USA) and followed by a secondary kit (Mouse Envision, DAKO-Agilent, Santa Clara CA, USA), stained with chromogen (3,3′-Diaminobenzidine [DAB] ...