Labshake search
Citations for Agilent :
1 - 50 of 1491 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... using Herculase II (Agilent) to amplify the DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... carrier pBlueScript II (Agilent) empty plasmid was used to bring the total amount of DNA up to 1 µg ...
-
bioRxiv - Biochemistry 2024Quote: ... or Herculase II (Agilent). PCR was performed for 16 cycles using primers with the desired nucleotides changes incorporated at or near the 5’ ends ...
-
bioRxiv - Genomics 2020Quote: ... 1X Herculase II Polymerase buffer and 1X Herculase II polymerase (Agilent Technologies, USA). We immediately thermo-cycled samples with the following temperature-time profile ...
-
bioRxiv - Cancer Biology 2020Quote: ... QuickChange II sitedirected mutagenesis (Agilent) was used to introduce a single mutation C402G to obtain a FOXL2C134W mutant ...
-
bioRxiv - Cell Biology 2019Quote: ... or Herculase II Fusion (Agilent) DNA polymerases with primers listed in Supplementary Table 5.
-
bioRxiv - Cancer Biology 2020Quote: QuikChange II mutagenesis kit (Agilent) was used to generate all RBM10 mutants ...
-
bioRxiv - Molecular Biology 2021Quote: ... GeneMorph II Random Mutagenesis Kit (Agilent) was used according to manufacturer’s recommendations using 500 ng CD19 minigene for 30 cycles at 56 °C with the amplification primers 5’-catAAGCTTgaccaccgccttcctctctg-3’ and 5’-catGAATTCNNNNNNNNNNNNNNNGGATCCttcccggcatctccccagtc-3’ ...
-
bioRxiv - Biophysics 2020Quote: ... QuickChange II mutagenesis kit (Agilent Technologies) was used to generate point mutations ...
-
bioRxiv - Cancer Biology 2021Quote: ... Herculase II Fusion DNA Polymerase (Agilent) was used for all reactions ...
-
bioRxiv - Cell Biology 2022Quote: ... Herculase II fusion DNA polymerase (Agilent) was used.
-
bioRxiv - Molecular Biology 2022Quote: ... PfuUltra II Fusion DNA polymerase (Agilent). The PCR cycle conditions were set to 98°C for 30 seconds as the denaturing step ...
-
bioRxiv - Molecular Biology 2022Quote: ... were added using Herculase II (Agilent) for the final PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... using Herculase II polymerase (Agilent, 600677) for library amplification ...
-
bioRxiv - Microbiology 2021Quote: UHPLC (Agilent Technologies 1260 Infinity II) was used to determine Monascus pigments ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1uL of Herculase II polymerase (Agilent), 1 uL of DMSO ...
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis (QuikChange II, Agilent) was used to introduce the Phe74 to Ala74 codon change in the OsTIR1 coding sequence of pHLP710 ...
-
bioRxiv - Bioengineering 2023Quote: ... the Herculase II polymerase (Agilent Technologies) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... using QuickChange II XL kit (Agilent) and the following primers were used to generate a point mutation on Serine 65 in Parkin (S65E) ...
-
bioRxiv - Developmental Biology 2023Quote: ... using Herculase II polymerase (Agilent, #600675) and was then sequenced to verify the presence/absence of the deletion ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µl Herc II polymerase (Agilent), and 35 µl nuclease-free water were added to the 40 µl gDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Herculase II polymerase (Agilent, USA) was employed ...
-
bioRxiv - Neuroscience 2022Quote: ... The N100A zDHHC/A17 mutants were generated by our laboratory by site-directed mutagenesis using primers designed by Agilent QuickChange II XL primer design software and using QuickChange II XL site-directed mutagenesis kit (Agilent Technologies), and confirmed by DNA sequencing through Eurofins Genomics (Louisville ...
-
bioRxiv - Microbiology 2022Quote: ... The MHC-II binding site mutations were introduced into pKK33 by site-directed mutagenesis (QuickChange II, Agilent Technologies) using the primer set SECF44A/L45Afor/ SECF44A/L45Arev ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Herculase II Fusion DNA Polymerase (Agilent). The libraries were sequenced on an llumina NextSeq 500 system with 75 bp read length ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we preformed PCR using PFUultra II (Agilent), the primers F1 and R3 5’gaggtgggcagtcatccatc3’ ...
-
bioRxiv - Genomics 2020Quote: ... the Herculase II Fusion DNA Polymerase (Agilent) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Site directed mutagenesis (Agilent’s QuickChange II kit) was performed using mutagenesis primers detailed in Supplemental Table 1 ...
-
bioRxiv - Genetics 2020Quote: ... Herculase II Fusion DNA Polymerase (Agilent Technologies), 0.25 mM dNTPs (100 mM ...
-
bioRxiv - Genetics 2020Quote: ... Herculase II Fusion DNA Polymerase (Agilent Technologies), 0.25 mM dNTPs (100 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... using PfuUltra II HS DNA Polymerase (Agilent) and primers oADW0274/0275 and cloned into Sma I/CIAP cut pLBG003 to generate plasmid pLBG007 [rips-1prom::RIPS-1::GFP::rips-1 3 UTR] (referred to as RIPS-1::GFP) ...
-
bioRxiv - Neuroscience 2021Quote: ... using QuikChange II XL (Agilent Cat #200521) and primers Irk1-RR-F and Irk1-RR-R ...
-
bioRxiv - Biophysics 2020Quote: ... The QuickChange Lightning II mutagenesis kit (Agilent) was used to create the I57A variant in the CI2_WT_pET22_mCherry vector ...
-
bioRxiv - Physiology 2022Quote: ... An HPLC 1290 Infinity II - (Agilent Technologies) consisting of a 4-channel binary pump ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using Herculase II (Agilent) or Q5 High-fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Immunology 2020Quote: ... Quick Change II Site-directed mutagenesis (Agilent) was used to revert mutated sites to the native sequence ...
-
bioRxiv - Genetics 2020Quote: ... 1 µl of Herculase II polymerase (Agilent), 1 µl of DMSO ...
-
bioRxiv - Microbiology 2020Quote: The GeneMorph II random mutagenesis kit (Stratagene) was used to mutagenize the TM2-HAMP-encoding region of phoQ (in pBAD33 phoQ ...
-
bioRxiv - Microbiology 2021Quote: ... or Herculase II fusion DNA polymerase (Agilent) was used for gyrA ...
-
bioRxiv - Molecular Biology 2021Quote: ... PfuUltra II Fusion HotStart DNA Polymerase (Agilent), Accuprime Taq (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... or Agilent Infinite II 1260 (Agilent Technologies) equipped with a refractive index detector and Hi-Plex H ...
-
bioRxiv - Cancer Biology 2022Quote: ... column and HPLC (Agilent 1260 Infinity II). The dried peptides were reconstituted in the mobile phase constituting 30% ACN + 0.1% TFA and loaded on to the column ...
-
bioRxiv - Systems Biology 2022Quote: ... 1 ul of Herculase II polymerase (Agilent), 1 ul of DMSO ...
-
bioRxiv - Cancer Biology 2022Quote: ... using Herculase II Fusion DNA Polymerase (Agilent) and 16 cycles ...
-
bioRxiv - Physiology 2023Quote: ... and pBluescript II SK+ vector DNA (Stratagene) as stuffer DNA to achieve a final concentration of 120 ng/μl ...
-
bioRxiv - Microbiology 2023Quote: ... using the QuikChange II kit (Agilent Technologies). The pCMP1:chpG:3XHA units were cloned into the E ...
-
bioRxiv - Microbiology 2023Quote: ... or Pfu ultra II fusion HS (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2) the pBluescript II SK (-) vector (Agilent) following EcoRV digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Herculase II Fusion DNA Polymerase (Agilent) and 16 cycles ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 μl of Herculase II polymerase (Agilent), 1 μl of DMSO ...