Labshake search
Citations for Agilent :
1 - 50 of 8199 citations for Two Hybrid System Construction kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... by using the BacterioMatch II two-hybrid system kit (Stratagene, San Diego, CA). In this assay ...
-
bioRxiv - Cell Biology 2021Quote: Yeast two-hybrid (Y2H) screens were performed using the HybriZAP two-hybrid cDNA synthesis kit (Stratagene, La Jolla, USA) as previously described (Maerker et al ...
-
bioRxiv - Plant Biology 2020Quote: ... as described in the GAL4 Two-Hybrid Phagemid Vector Kit manual (Agilent Technologies).
-
bioRxiv - Plant Biology 2020Quote: LiAc yeast transformation was performed as described in the GAL4 Two-Hybrid Phagemid Vector Kits manual (Agilent Technologies). The constructions including either DNA binding domain or activation domain were co-transformed into yeast strain PJ69-4a ...
-
bioRxiv - Genomics 2019Quote: ... Library construction (Agilent SureSelect Human All Exon kit), quality assessment ...
-
bioRxiv - Neuroscience 2021Quote: The hydrophilic N-terminal region of CLN6 was screened against a human fetal brain library using Stratagene’s Cytotrap yeast two-hybrid system (Y2H) as previously published (Stratagene, La Jolla, CA). Briefly ...
-
bioRxiv - Developmental Biology 2021Quote: ... or the Illumina TruSeq Stranded Total RNA Library Prep kit (medaka hybrid and mCherry or KDM4E-injected zebrafish samples) and checked using a Fragment Analyzer System (Agilent) before multiplexing ...
-
bioRxiv - Biochemistry 2023Quote: The two-column system (1290 Infinity II (Agilent)) with two binary pumps connected to two positions of the ten port valve was equipped with two 30 × 2.1 mm Luna OMEGA 1.6 μm C18 100 Å (Phenomenex ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The two used chromatography systems consisted of an isocratic pump (HP1100, Agilent, Waldbronn ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA from various tissues (Supplemental Table 6) was purified and used for library construction with target enrichment using the SureSelectQXT Target Enrichment kit (Agilent). Custom RNA capture probes were designed to hybridize with the 120 bp 5’ ends of the 5’LTRs and the 120 bp 3’ ends of the 3’LTR of about 600 intact (internal region flanked by two LTRs ...
-
bioRxiv - Genomics 2020Quote: ... using the ‘Two color low input Quick Amp labelling kit’ (Agilent) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Two different PCR systems were adopted: Herculase II Fusion DNA polymerase (Agilent, part#600679), and Accuprime Pfx DNA polymerase PCR system (Thermofisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were constructed and sequenced similarly to the WGS experiment following hybrid capture selection with the hybrid reagent SureSelect DNA - Mouse All Exon V1 (Agilent). WES reads were aligned to the GRCm38 reference genome using BWA-MEM ...
-
bioRxiv - Developmental Biology 2020Quote: ... Post cDNA amplification and post library construction quality control was performed using the Agilent Bioanalyzer High Sensitivity kit (Agilent 5067-4626). Libraries were sequenced using a NovaSeq 6000 and the S2 flow cell ...
-
bioRxiv - Developmental Biology 2024Quote: ... Post cDNA amplification and post-library construction quality control was performed using the Agilent Bioanalyzer High Sensitivity kit (Agilent 5067–4626). Libraries were sequenced using a NovaSeq 6000 and the S2 flow cell ...
-
bioRxiv - Microbiology 2020Quote: ... LC-ESI-HRMS2 analyzes were achieved by coupling the LC system to a hybrid quadrupole time-of-flight (QToF) mass spectrometer Agilent 6538 (Agilent Technologies) equipped with a Dual electrospray ionization (ESI) ...
-
bioRxiv - Microbiology 2023Quote: ... As previously outlined the LC-electrospray ionization (ESI)-HRMS2 analyses were achieved by coupling the LC system to a hybrid quadrupole time-of-flight (QTOF) mass spectrometer Agilent 6538 (Agilent Technologies) equipped with dual electrospray ionization (ESI ...
-
bioRxiv - Developmental Biology 2020Quote: Library construction was performed on total RNA (RIN ≥9.0 assessed with Agilent 6000 Nano analysis ...
-
bioRxiv - Cancer Biology 2019Quote: ... we undertook massively parallel sequencing using a solution-phase SureSelect hybrid capture kit (Agilent Technologies, Santa Clara, CA, USA) and an HiSeq 2500 sequencer (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... The size range and concentration of final library constructions was verified by Agilent 2100 Bioanalyzer.
-
bioRxiv - Genetics 2020Quote: ... Variants were introduced into the wild type constructions using the Quick-change II XL site-directed mutagenesis kit (Agilent, Santa Clara, CA, USA). Presence of an abnormally spliced transcript associated with the decrease of the normal transcript was considered as “Impact on splicing” ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using a microplate reader (Agilent BioTek Synergy H4 Hybrid, Agilent). Pulled-down percentages were normalized as
-
bioRxiv - Synthetic Biology 2023Quote: ... using a microplate reader (Agilent BioTek Synergy H4 Hybrid, Agilent). Pulled-down percentages were normalized as
-
bioRxiv - Molecular Biology 2020Quote: ... RNA labeling was performed with the two color ‘Quick Amp Labeling Kit’ (Agilent genomics) using a 1:5 mixture of ‘FullSpectrum MultiStart Primer’ (Systembio) ...
-
bioRxiv - Bioengineering 2020Quote: ... Post library construction quantification was done using a High Sensitivity D1000 ScreenTape Assay (Agilent) on a 4200 TapeStation System (Agilent) ...
-
bioRxiv - Molecular Biology 2020Quote: The two linkers were optimized separately using Quikchange II site-directed mutagenesis Lightening kit (Agilent) with customized primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Two PstI sites on the vector were mutated with a site-direct mutagenesis kit (Agilent)—PstI-free pcDNA3.1(+ ...
-
bioRxiv - Neuroscience 2019Quote: Fractions were reconstituted in 10% FA and analyzed in two technical replicates with a UHPLC 1290 system (Agilent technologies) coupled to an Orbitrap Q Exactive X mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quality was assessed before the RNA-seq library construction by Bioanalyzer RNA 6000 (Agilent Technologies, Inc). The library was sequenced on an Illumina HiSeq platform ...
-
bioRxiv - Plant Biology 2023Quote: Gene expression analysis was performed in two technical replicates for each biological replicate on a Mx3005P qPCR system (Stratagene, USA) and FIREPol EvaGreen qPCR Mix Plus (Solis Biodyne ...
-
bioRxiv - Genomics 2021Quote: ... we performed another secondary analysis between two groups of control samples (Leicester study controls vs. Ottawa and ATVB controls) representing two main enrichment kits (Illumina ICE vs. Agilent SureSelect kits). The statistical analysis was performed in R 3.3.3 (55) ...
-
bioRxiv - Genetics 2020Quote: ... Agilent SureSelect Target Enrichment System kit (Agilent technology ...
-
bioRxiv - Microbiology 2019Quote: ... the experiments were done with two independent hybridizations for miRNA (Agilent’s miRNA Complete Labeling and Hyb Kit) or for mRNA (Cy3 and Cy5 interchanging labeling) ...
-
bioRxiv - Microbiology 2020Quote: ... Two rounds of error-prone PCR were performed using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). The PCR product was cloned into the PADL22c vector and transformed via electroporation into the TG1 E ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Developmental Biology 2023Quote: ... The dCas9-KRAB donor was generated through two rounds of QuikChange II Site-Directed Mutagenesis Kit (Agilent), using Puro-Cas9 donor (Addgene plasmid 58409 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 x106 cells were divided in two fractions- for FITC labelled Telomeric PNA probe (Agilent DAKO kit) and unlabelled control cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 x106 cells were divided in two fractions- for FITC labelled Telomeric PNA probe (Agilent DAKO kit) and unlabelled control cells ...
-
bioRxiv - Developmental Biology 2020Quote: Library construction was performed on total RNA (RIN ≥9.0 assessed with Agilent 6000 Nano analysis, Agilent Technologies), using pipeline for poly(A)-selected/ribo-depleted strand-specific mRNA-seq library construction from the Michael Smith Genome Sciences Centre ...
-
bioRxiv - Plant Biology 2020Quote: ... Sample labeling was done following the Low Input Quick Amp Labelling protocol of the Two-Color Microarray-Based Gene Expression Analysis system (Agilent Technologies). Hybridizations were done using a custom 4×44 k oligoarray (Agilent Technologies ...
-
bioRxiv - Genomics 2022Quote: ... system with a Sandard NGS kit (Agilent, USA). The amplicons libraries construction was done according the Nanopore protocole NBA_9102_V109_revA_09Jul2020 ...
-
bioRxiv - Cancer Biology 2024Quote: ... at 1:400 for two hours and then incubated for 30 minutes with Rabbit Envision HRP System reagent (Agilent, Santa Clara, CA). For vimentin staining ...
-
bioRxiv - Cancer Biology 2019Quote: Two-channel microarray experiment was performed with two replicates using the Agilent Whole Human Genome Oligo Microarray (Agilent, catalog #G4851C Whole Human Genome Microarray 8×60K) ...
-
bioRxiv - Biochemistry 2021Quote: ... Two variants were created by site-directed mutagenesis using a QuikChange site-directed mutagenesis kit (Stratagene, San Diego, CA) with the primer pairs displayed in Supplementary Table 3 ...
-
bioRxiv - Pathology 2021Quote: ... Slides were again washed in TBS-T two times followed by incubation with anti-rabbit EnVision detection kit (DAKO) for 1 hour in room temperature ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The resulting two vectors were then subjected to site-directed mutagenesis (QuickChange II XL Site-Directed Mutagenesis Kit; Agilent Technologies ...
-
bioRxiv - Systems Biology 2023Quote: ... Transcriptome and barcode amplicon library construction was verified using an Agilent 4200 TapeStation and D1000 tape (Agilent #5067-5582) and quantified by qPCR using a Roche LightCycler 480 and Illumina Library Quantification Kit (Kapa Biosystems #KK4854) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... We used a Dako EnVision Systems HRP kit (Dako) for the secondary antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... The DNA 100 Chip kit and Tapestation system (Agilent) was used to assess the quality of cDNA libraries generated ...
-
bioRxiv - Microbiology 2020Quote: ... for two-color microarray-based expression analysis (Agilent). The Pfalcip_Agamb2009 microarray platform (designed by Dr ...