Labshake search
Citations for Agilent :
1 - 50 of 6356 citations for Triiodothyronine T3 ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The plate was then measured using a BioTek ELX808 ELISA reader (Agilent) at 450nm and 620-650nm ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were washed between all experimental step with PBS plus 0.1% Tween 20 (405 TS ELISA Plate Washer, Agilent Technologies). Blocking (1% Omniblok ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Plant Biology 2021Quote: ... Anthocyanins were separated using an C18 column (HSS T3, 2.1×100mm, 1.8um, Agilent Technologies) and a gradient of water (A ...
-
bioRxiv - Molecular Biology 2022Quote: ... Data were collected on a Cytation 5 plate reader (Agilent Technologies) using a green fluorescent polarization filter (excitation and emission wavelengths of 485 nm and 528 nm ...
-
bioRxiv - Molecular Biology 2020Quote: ... and used for the synthesis of cRNA probe using T3 and T7 RNA polymerases (Stratagene) and a digoxigenin labeling mix (Roche ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Immunology 2023Quote: Antibodies against SARS-CoV-2 were measured using a high-throughput direct chemiluminescent ELISA performed on MicroLab STAR robotic liquid handlers (Hamilton) fitted with a 405TS/LS LHC2 plate washer (Biotek/Agilent) (full methods described previously)27 ...
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Biophysics 2022Quote: ... or aged samples (T ~ 24 hours) were imaged directly in sealed 384-well microwell plates with a BioTek Cytation Gen 5 imaging plate reader (Agilent) using a 20 x objective ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Samples were analysed with liquid chromatography (reversed phase Atlantis T3 C18 column) coupled by mass spectrometry (Agilent Zorbax Eclipse XDB-C18 2.1 × 150 mm 3.5µ m column ...
-
bioRxiv - Cancer Biology 2022Quote: 5 × 104 cells were plated on XF24 cell culture plate (Agilent, no. 100777-004) with DMEM supplemented with 1 % FBS ...
-
bioRxiv - Microbiology 2023Quote: ... The fixed plates were scanned using the high-content imaging system Cytation 5 (Agilent), with either the GFP channel for rVSV-S or the Texas red channel for rSARS-CoV-2 virus ...
-
bioRxiv - Cancer Biology 2023Quote: ... plates were transferred to the Cytation 5 Cell Imaging Multi-Mode Reader (Biotek/Agilent) driven by Gen5 software (Biotek/Agilent) ...
-
bioRxiv - Cell Biology 2024Quote: 96-well plates containing single-cell clones were imaged on a Cytation 5 microscope (Agilent) 10 days after sorting ...
-
bioRxiv - Cell Biology 2024Quote: ... QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523-5) was used for mutagensis of GFP-VPS35L constructs following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates were consecutively incubated with: rabbit anti-total tau antibody (K9JA, Dako #A0024, 5 μg/ml), anti-rabbit secondary antibody conjugated with biotin (Invitrogen #A16114 ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was then placed in a BioTek Cytation 5 Cell Imaging Multi-Mode Reader (Agilent) and incubated at 37 °C for 3 hours ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... Samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 µm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15 ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Cancer Biology 2021Quote: ... Compound incubated plates and basal plates were then washed with assay media (Seahorse XF DMEM assay media kit (Agilent; #103575-100), 10 mM glucose ...
-
bioRxiv - Systems Biology 2023Quote: ... The cells were plated at 15,000 cells/well onto fibronectin-coated (5 μg/cm2) xCELLigence E-plate (Agilent) wells in serum free medium ...
-
bioRxiv - Bioengineering 2023Quote: All kinetic data were obtained using either a BioTek Synergy H1 or Cytation 5 plate reader (Agilent Technologies). HEX was measured with an excitation peak of 533 nm and an emission peak of 559 nm with a gain of 80 to 100 to ensure fluorescence values were within the linear range of detection ...
-
bioRxiv - Neuroscience 2023Quote: ... The plate was thoroughly washed 5 times with PBS-T and 100 μL of TMB-Blue substrate (DAKO) was added followed by incubation in the dark for 5-10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... the plate containing the follicles was transferred to a live-cell imaging system (Agilent BioTek Cytation 5, USA) to capture images at 6-minute intervals during ovulation ...
-
bioRxiv - Microbiology 2022Quote: ... DirectDrive2 spectrometer operating at a 1H frequency of 600 MHz and using a 3.2-mm T3 HXY Magic Angle Spinning (MAS) probe (Agilent Technologies, Santa Clara, CA). These data were acquired on 34.1 and 39.7 mg ...
-
bioRxiv - Biophysics 2020Quote: ... instrument operating at a 1H frequency of 600 MHz and equipped with a 3.2-mm T3 HXY MAS probe (Agilent Technologies, Santa Clara, CA). All data were acquired on ~12-18 mg of lyophilized melanin ghost or whole cell samples using a Magic Angle Spinning (MAS ...
-
bioRxiv - Microbiology 2021Quote: ... All data were acquired on ~8-10 mg of lyophilized material using a 1.6-mm T3 HXY fastMAS probe (Agilent Technologies, Santa Clara, CA) with a magic-angle spinning (MAS ...
-
bioRxiv - Microbiology 2022Quote: ... instrument operating at a 1H frequency of 600 MHz and equipped with a 1.6-mm T3 HXY fastMAS probe (Agilent Technologies, Santa Clara, CA). The data were acquired on 6-8 mg of lyophilized cell material using a MAS rate of 15.00 ± 0.02 kHz at a spectrometer-set temperature of 25 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... spectrometer operating at a 1H frequency of 600 MHz and equipped with a 1.6-mm T3 HXY fastMAS probe (Agilent Technologies, Santa Clara, CA); all measurements were carried out using a magic-angle spinning (MAS ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2021Quote: ... Site-Directed Mutagenesis using the QuikChange II XL kit (Agilent, #200522-5) was performed and the mutations were confirmed by sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... After centrifugation plate was incubated for 5 minutes before being loaded into a Seahorse XF96 Extracellular Flux Analyzer (Agilent). Basal respiration was measured over six hours with 36 ten-minute protocol cycles including a ...
-
bioRxiv - Biochemistry 2023Quote: ... Colonies were stained with Wright-Giesma and plates were scanned using the Biotek Cytation 5 Imaging Multimodal Reader (Agilent). From scanned images ...
-
bioRxiv - Physiology 2024Quote: ... live cells stained with Hoechst 33342 (1:2,000 dilution) (ThermoScientific, Cat#62249) were enumerated using Cytation 5 plate reader (BioTek Instruments - Agilent). Values obtained from the Mito-Stress test were normalized per 1,000 cells.
-
bioRxiv - Genetics 2022Quote: ... The purified construct was linearized using XbaI for in vitro complementary RNA (cRNA) transcription with T3 RNA polymerase (Agilent Technologies, Inc., Santa Clara, CA). Synthesized cRNA was purified with the RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... (https://www.shimadzu.com.cn/) system composed of Waters Acquity I-Class instrument equipped with UPLC HSS T3 column (Agilent SB-C18, 1.8μm, 2.1 mm × 100 mm). For positive and negative ion mode (ESI-MS) ...
-
bioRxiv - Bioengineering 2023Quote: ... The luminescence signal which represents the amount of ATP in viable cells was measured with a microtiter well plate reader (BioTek Cytation 5, Agilent).
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were spun down 500 g for 5 min followed by sealing with optical clear permanent seal (Agilent, 24212-001) using the Plateloc Thermal Microplate Sealer (Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: 250 M10M6-PtenC124S cells and 750 M10M6-PtenWT cells were seeded in 384 well plate with 40 µL RPMI-1640 medium containing 5% FBS using Bravo automated liquid handling platform (Agilent). After 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μl were aliquoted into black 96 well plates in triplicate and fluorescence was measured using a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The excitation wavelength used was 488 nm and emission wavelength used was 530 nm.
-
Critical contribution of mitochondria in the development of cardiomyopathy linked to desmin mutationbioRxiv - Pathology 2023Quote: ... seeded (25,000-50,000 cells/well) on Matrigel coated test plates (Extracellular Flux Assay Kit, Agilent) and cultured 4 days in maturation medium prior to measurement ...
-
bioRxiv - Genomics 2021Quote: ... Plates were sealed with a plate-loc (Agilent) and centrifuged for an additional 20 min allowing cells to settle on the pre-dispensed gel ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then washed and 5 × 105 osteoclasts were seeded onto a XF96 plate containing Seahorse XF RPMI medium (Agilent Technologies). The cells were left for 1 h at 37 °C after which the different metabolic drugs were injected (oligomycin 1μM ...
-
bioRxiv - Bioengineering 2024Quote: ... Fluorescence was quantified using an excitation of 530/15 nm and emission of 590/15 nm on a fluorescent plate reader (BioTek Cytation 5, Agilent Technologies).
-
bioRxiv - Bioengineering 2024Quote: ... DMMB solution was added (200 µL/well) and absorbance was measured at 540 nm and 590 nm using a plate reader (BioTek Cytation 5, Agilent Technologies). For all samples ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were sealed using a PlateLoc plate sealer (Agilent) with optical clear seal ...
-
bioRxiv - Bioengineering 2022Quote: ... and the plates were incubated at 37 °C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 45 hours.