Labshake search
Citations for Agilent :
1 - 50 of 137 citations for Super Resolution microscope since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... coli XL1Blue super-competent cells (Agilent) for propagation ...
-
bioRxiv - Microbiology 2019Quote: ... we used high resolution dual-color imaging on an inverted Nikon Ti-Eclipse TIRF microscope equipped with an Agilent laser source (Agilent) producing approximately 65 mW of 488-nm and 561-nm light at the fiber exit ...
-
bioRxiv - Cell Biology 2021Quote: Microscopic observation of Arabidopsis plantlets attacked with pathogens was performed using an inverted spinning disk confocal microscope with a high-resolution camera (Yokogawa CSU-X1 on Nikon Ti-E platform, laser box Agilent MLC400 ...
-
bioRxiv - Cancer Biology 2023Quote: High resolution mass spectrometry was obtained by Agilent 6224 TOF LC/MS Mass Spectrometer coupled to an Agilent 1290 Infinity (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: Low resolution mass spectrometry was obtained by Agilent 1260 Infinity II LCMS SQ equipped with a 1260 Infinity G1312B Binary pump and a 1260 Infinity G1367E 1260 HiP ALS autosampler ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scanning of microarrays was performed with 3 μm resolution (8×60K) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Molecular Biology 2020Quote: ... Scanning of the microarrays was performed with 5 µm resolution and the extended mode using a ‘High Resolution Microarray Laser Scanner’ (G2505, Agilent Technologies). Raw microarray image data were extracted and analyzed with the ‘G2567AA Image Analysis / Feature Extraction software’ (Version A.10.5.1.1 ...
-
bioRxiv - Microbiology 2021Quote: ... and transformed into XL1-Blue super-competent cells (Agilent). Bacterial colonies were sequenced to confirm the correct mutations ...
-
bioRxiv - Biochemistry 2021Quote: ... All compounds reported were confirmed by low-resolution MS (Agilent 6120 Quadrupole LCMS system ...
-
bioRxiv - Genomics 2020Quote: ... RNA integrity was assessed with high resolution capillary electrophoresis (Agilent Technologies) and only RNA with RNA Integrity Number (RIN ...
-
bioRxiv - Synthetic Biology 2020Quote: ... using an Agilent 1200 Rapid Resolution LC system (Agilent Technologies, United States). The mobile phase was composed of water (solvent A ...
-
bioRxiv - Plant Biology 2023Quote: ... 1.8 μm Zorbax RRHD (Rapid Resolution High Definition) C18 column (Agilent Technologies) with a 21 min gradient and 0.4 mL/min flow rate ...
-
bioRxiv - Cancer Biology 2021Quote: ... staining was revealed using the IDetect Super strain HRP polymer kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Phage particles were prepared by super-infection with VCS13 helper phage (Agilent). The phage preparation was concentrated by adding 1/5th volume of 20%(W/v ...
-
bioRxiv - Microbiology 2020Quote: ... and 600 ng were hybridized with a high-resolution custom-made microarray (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... LC/MS analysis was performed on a 6546 High-Resolution Q-TOF (Agilent), utilizing an Atlantis dC18 C18 UPLC column (Waters) ...
-
bioRxiv - Neuroscience 2022Quote: ... High resolution MS data were analyzed using MassHunter Qualitative Analysis B.07.00 (Agilent). MS files were converted to MGF format using Proteowizard’s MSConvert tool (Chambers et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... were separated on a Zorbax Eclipse Plus C18 Rapid Resolution column (Agilent Technologies) (100 mm x 4.6 mm ...
-
bioRxiv - Plant Biology 2024Quote: ... The analysis was performed by a low-resolution mass spectrometer (Agilent model 5977B) with quad-coupled analyser coupled to a gas chromatograph (Agilent model 7890B) ...
-
bioRxiv - Microbiology 2021Quote: ... with high-resolution mass spectrometry (6540 Q-TOF-MS, Agilent Technologies, Santa Clara, CA) for non-targeted metabolite profiling [47–49] ...
-
bioRxiv - Microbiology 2023Quote: ... high-resolution gel electrophoresis with a Bioanalyzer instrument and DNA 7500 Pico reagents (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... Chromatographic resolution was obtained in reverse phase on a Zorbax SB-C18 (1.8 μm; Agilent) for amino acids and an Eclipse Plus C18 (1.8 μm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with a Zorbax Rapid Resolution HT C18 column (50 × 2.1 mm, 1.8 μm; Agilent Technologies). Metabolites were separated using the following gradient ...
-
bioRxiv - Molecular Biology 2022Quote: ... Conventional sequencing transformations into XL1-Blue Super competent cells (Agilent Technologies, Santa Clara, CA, USA) were used for all ligations ...
-
bioRxiv - Biophysics 2020Quote: MR measurements were performed on an Agilent Unity INOVA 400WB high-resolution NMR system (Agilent Technologies). A 9.4 T vertical magnet with a bore width of 89 mm (Oxford Instruments ...
-
bioRxiv - Microbiology 2020Quote: ... Mass spectrometry was performed using a high-resolution 6540 QTOF/MS Detector (Agilent, Santa Clara, USA). Spectra were recorded in a mass range from 50 m/z to 1700 m/z in positive and negative ionization mode ...
-
bioRxiv - Microbiology 2019Quote: ... Hybridized arrays were scanned at 5 μm resolution on a Microarray Scanner (Agilent p/n G2565BA). Data extraction from images was done by using Agilent Feature Extraction (FE ...
-
bioRxiv - Biophysics 2022Quote: ... coupled with a high-resolution mass spectrometer (6350 Accurate-Mass Q-TOF LC/MS, Agilent Technologies). The HPLC separation was carried out on a C18 column (100 mm×2.1 mm ...
-
bioRxiv - Immunology 2024Quote: Real-time ChIP-qPCR was performed with the Brilliant II SYBR green super mix (Agilent, USA). Forward (AGTGGTGACCTTGAACTTCCC ...
-
bioRxiv - Molecular Biology 2021Quote: In vitro transcribed RNAs were analyzed by high resolution electrophoresis using the RNA 6000 Nano Kit (Agilent). Purified RNA transcript solutions were incubated at 95 °C for 2 min for denaturation ...
-
bioRxiv - Genetics 2022Quote: ... Slides were scanned using a G2565 scanner at 3-lm resolution (Agilent Technologies, Palo Alto, CA, USA), and array images were analyzed using NimbleScan v2.5 software (Roche NimbleGen) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Microarray slides were scanned using a DNA Microarray scanner with Surescan High-Resolution Technology (Model 2565CA, Agilent).
-
bioRxiv - Synthetic Biology 2020Quote: ... The Agilent 1200 Rapid Resolution LC system was coupled to an Agilent 6210 TOF (Agilent Technologies, United States). Nitrogen gas was used as both the nebulizing and drying gas to facilitate the production of gas-phase ions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Profiling of the extracted RNA was performed using high-resolution automated electrophoresis on a 2100 Bioanalyzer (Agilent, G2939BA), according to instructions for the RNA 6000 Pico Kit (Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: ... The column was a ZORBAX Rapid Resolution HD (2.1 × 150 mm, 1.8 µm pore size; 759700-902, Agilent). Mobile phase A was 3% methanol (in H2O) ...
-
bioRxiv - Biochemistry 2022Quote: ... coupled to a Q-Exactive Plus Orbitrap MS (Thermo) using a C18 column (Zorbax Eclipse Plus C18 Rapid Resolution HD 2.1 x 100mm 1.8 micron, Agilent) with a binary solvent system ...
-
bioRxiv - Biochemistry 2023Quote: ... The LC column compartment was equipped with a Zorbax 300SB-C8 Micro Bore Rapid Resolution column (length: 150 mm, inner diameter: 1.0 mm, particle size: 3.5 µm, part number: 863630-906, Agilent). Acetonitrile ...
-
bioRxiv - Biochemistry 2024Quote: ... coupled to a Q-Exactive Plus Orbitrap MS (Thermo) using a C18 column (Zorbax Eclipse Plus C18 Rapid Resolution HD 2.1 x 100mm 1.8 micron, Agilent) with a binary solvent system ...
-
bioRxiv - Plant Biology 2021Quote: ... coupled to a high resolution 6545 quadrupole time-of-flight mass spectrometer (QTOF-MS) (Agilent, Santa Clara, CA, USA). The MS was run using electrospray ionization and operated in both positive and negative modes using reference masses for accurate mass determination.
-
bioRxiv - Plant Biology 2022Quote: ... Compounds were separated on a Zorbax Extend-C18 Rapid Resolution HT column (2.1 × 50 mm, 1.8 μm; Agilent Technologies). The gradient elution mobile phase consisted of H2O with 0.1% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... Microarray images were collected by using sure scan microarray scanner system at 5 μm resolution (Agilent Technologies, Scanner 2600D). Fluorescent intensities were quantified using feature extraction software ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were revealed by chemi-luminescence (Super Signal West Dura Substrate, Pierce) using a secondary peroxydase-conjugated antibody (Dako) at a dilution of 1:10000 ...
-
bioRxiv - Plant Biology 2021Quote: ... The Zorbax Eclipse Plus C-18 column Rapid Resolution HT (3 X 100 mm, 1.8 μm, 600 bar, Agilent, USA) was kept at 25°C and the elution was performed with acetonitrile (Optima ...
-
bioRxiv - Genomics 2022Quote: ... Arrays were read using an Agilent scanner at 2 μm resolution and the signal segmentation was done using the feature extraction software (Agilent). The data was normalized without background subtraction using the global Lowess method (74).
-
bioRxiv - Microbiology 2020Quote: ... Small RNAs (6–150 nucleotides) and microRNA fractions (10–40 nucleotides) were quantified using high-resolution small RNA analysis (Agilent 2100 Bioanalyzer system ...
-
bioRxiv - Biochemistry 2021Quote: ... Dried samples were reconstituted in 0.1% formic acid in water and 5 µL were injected into a 1290 UHPLC liquid chromatography (LC) system interfaced to a high-resolution mass spectrometry (HRMS) 6550 iFunnel Q-TOF mass spectrometer (MS) (Agilent). The MS was operated in both positive and negative (ESI+ and ESI- ...
-
bioRxiv - Microbiology 2022Quote: Metabolites were analyzed by flow injection into a high-resolution quadrupole time-of-flight (QTOF) mass spectrometer (Agilent QTOF 6546) as described previously (64) ...
-
bioRxiv - Microbiology 2023Quote: ... solution and 3 μl of each sample were subjected to high-resolution liquid chromatography-mass spectrometry (LC-MS) analysis (Agilent iFunnel 6550 quadrupole time-of-flight (QTOF) ...
-
bioRxiv - Neuroscience 2023Quote: ... equipped with a precolumn (Zorba-SB-C8 Rapid Resolution Cartridge, 2.1 × 30mm, 3.5 µm particle size, Agilent Technologies, Barcelona, Spain) and with a column temperature of 60°C ...