Labshake search
Citations for Agilent :
1 - 50 of 1203 citations for Recombinant Mouse Shh His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: The pET-30a-PHB1 vector encoding His-tagged mouse PHB1 was transformed into Escherichia coli strain BL21 Star (DE3; Stratagene). The resulting N-terminal His-tagged recombinant PHB1 was purified using Ni-Sepharose 6 Fast Flow (GE Healthcare) ...
-
bioRxiv - Cell Biology 2021Quote: ... The mGli2-His recombinant protein was expressed in BL21 (DE3) pLysS cells (Stratagene) and purified under denaturing condition (8 M urea ...
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Biochemistry 2022Quote: ... constructs containing DNA encoding 8X-His-tagged CHI-domain-containing proteins were transformed into BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent) for recombinant protein expression ...
-
bioRxiv - Cell Biology 2020Quote: ... a Bgl2 site was introduced into SHH-FL after Gly198 by Quikchange (Agilent) using primers (forward 5’ GTGGCGGCCAAATCCGGCGGCAGATCTGGCTGTTTCCCGGGATCCGCC and reverse 5’ ggcggatcccgggaaacagccagatctgccgccggatttggccgccac) ...
-
bioRxiv - Immunology 2023Quote: ZIKV NS2B-NS3pro recombinant constructs with N-terminal His tag were used to transform competent E.coli BL21 (DE3) Codon Plus cells (Stratagene). Transformed cells were grown at 30°C in LB broth containing carbenicillin (0.1 mg/ml) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plasmids containing the C- and N-terminally His-tagged human ACSS2 DNA were transformed into BL21 (DE3) RIL competent cells (Agilent Technologies, Wilmington, DE) and were expressed in auto-inducing media ZYP-5052 overnight at 15°C with shaking at 225 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary antibodies tagged with Horse Radish Peroxidase (HRP; Dako) were incubated for 1 h at room temperature under rotation ...
-
bioRxiv - Immunology 2024Quote: ... a biotin-tagged polyclonal anti-C1q Ab (Agilent, A0136) was incubated for 1 hr at RT followed by HRP-coupled streptavidin 1:10000 and TMB One.
-
bioRxiv - Genetics 2024Quote: Recombinant adenoviruses expressing mouse SAR1A or SAR1B were constructed using pAdTrack-CMV and the AdEasy adenoviral vector system (Agilent Technologies, Lexington MA). Adenoviruses were amplified in Ad293 cells and purified using CsCl gradient ultracentrifugation ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 μL of AccuScript Hi-Fi (Agilent Technologies) was added up to a 10 μL volume ...
-
bioRxiv - Microbiology 2022Quote: ... A 300×7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Genomics 2023Quote: ... were used to assess the Hi-C libraries (Agilent). The libraries were sequenced at New York Genome Center (NYGC ...
-
bioRxiv - Systems Biology 2023Quote: ... A 300 × 7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Biochemistry 2019Quote: ... hexahistidine-tagged IN was overexpressed in BL-21 CodonPlus RIL cells (Agilent). Cells were lysed in 25 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Dual-tagged Slit2 Δ construct was obtained by Quickchange mutagenesis procedure (Agilent), deleting 9 amino acids (SPPMVLPRT ...
-
bioRxiv - Biophysics 2022Quote: ... Recombinant plasmids were transformed in XL1Blue (Agilent Technologies) or Top10 (Thermofisher scientific ...
-
bioRxiv - Microbiology 2024Quote: ... and a 300×7.8 mm Hi-Plex Exchange column (Agilent, USA) was used to quantify glucose ...
-
bioRxiv - Biophysics 2019Quote: ... Recombinant human tropomyosin was purified from BL21-CodonPlus (Agilent) using established protocols (91 ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminally His6-tagged KRAS was expressed in BL21-CodonPlus(DE3)-RIL cells (Stratagene) by isopropyl-β-D-1-thiogalactopyranoside induction at 18 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... HA-tagged DCX mutant T203R were created using QuikChange Site-Directed Mutagenesis kit (Stratagene). HA-tagged DCX mutant A71S was synthesized commercially (Genewiz ...
-
bioRxiv - Microbiology 2022Quote: OPG2-tagged ORF3c plasmids were generated by site-directed mutagenesis (Stratagene QuikChange, Agilent Technologies) and confirmed by DNA sequencing (GATC ...
-
bioRxiv - Microbiology 2022Quote: OPG2-tagged ORF3c plasmids were generated by site-directed mutagenesis (Stratagene QuikChange, Agilent Technologies) and confirmed by DNA sequencing (GATC ...
-
bioRxiv - Cell Biology 2023Quote: ... GST-tagged proteins were purified from BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent, 230280) as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... the CBP-tagged Drp1 was purified by affinity chromatography using calmodulin agarose resin (Agilent) that had been pre-equilibrated with CalA Buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... the CBP-tagged Drp1 was purified by affinity chromatography using calmodulin agarose resin (Agilent) that had been pre-equilibrated with CalA Buffer ...
-
bioRxiv - Immunology 2024Quote: ... C4b deposition was measured using a biotin-tagged anti-C4c polyclonal Ab (Agilent, Q0369) followed by HRP-streptavidin and TMB One ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed using Accuscript Hi Fidelity First Strand Synthesis kit (Agilent). The amount of RNA entered into the reaction was normalised between samples ...
-
bioRxiv - Molecular Biology 2019Quote: pTrex-6×His-TOP1Y723F was generated by QuikChange II XL SDM kit (Agilent) using oligonucleotides 5’-CTAGGGTCCAGAAAATTGAGTTTGGAGGTTCCCAGG-3’ pTrex-6×His-TOP1 K117 ...
-
bioRxiv - Developmental Biology 2019Quote: ... while the MURF1 cDNA fragment was cloned into myc-tagged pCMV-Tag3 (Stratagene, CA, USA). These constructs were sequenced to ensure that no errors were introduced.
-
bioRxiv - Cell Biology 2019Quote: ... GST-tagged Nup153228-611 and Nup50 (full length) were purified from BL21-DE3 (Stratagene 230245) cells as described above.
-
bioRxiv - Microbiology 2021Quote: ... The 5-AIQC-tagged samples (1 μL) were individually injected on an UPLC column (Agilent ZORBAX RRHD Eclipse XDB C18 column ...
-
bioRxiv - Biophysics 2023Quote: Halo-tagged dCas9 protein expression was induced in BL21-CodonPlus(DE3)-RIL cells (Agilent #230245) transformed with pET302-6His-dCas9-halo (Addgene #72269 ...
-
bioRxiv - Biochemistry 2023Quote: ... All recombinant plasmids were transformed into XL1-Blue competent cells (Agilent) and sequenced for verification.
-
bioRxiv - Genomics 2019Quote: ... The concentration of the Hi-C libraries was determined by Bioanalyzer profiles (Agilent Technologies), and the Hi-C libraries were paired-end sequenced (HiSeq 2500 ...
-
bioRxiv - Biochemistry 2021Quote: ... and the reaction was stopped by adding 2X GE HI-RPM hybridization buffer (Agilent Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... N2081D and G2385R mutant GFP-tagged LRRK2 constructs were generated by site-directed mutagenesis (QuikChange, Stratagene), and identity of all constructs verified by sequencing of the entire coding region ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantity and integrity of the Hi-C libraries was determined by Bioanalyzer profiles (Agilent Technologies).
-
bioRxiv - Microbiology 2022Quote: ... the stationary phase was a Hi-Plex H column (300 x 7.7 mm; Agilent, USA) and the mobile phase was 0.005 M H2SO4 solution at a flow rate of 0.4 ml/min ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Biochemistry 2020Quote: Skd3 variants were expressed as an N-terminally MBP-tagged protein in BL21 (DE3) RIL cells (Agilent). Cells were lysed via sonication in 40mM HEPES-KOH pH=7.4 ...
-
bioRxiv - Cell Biology 2021Quote: Constructs encoding the 6His-SUMO tagged proteins were transformed into chemically competent BL21(DE3) Escherichia coli (Agilent). A fresh bacteria colony was inoculated to 10 ml LB broth containing 200 μg/ml Ampicillin and 50 μg/ml Chloramphenicol and grown at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... TAP-tagged proteins were detected using rabbit antiperoxidase antibody linked to peroxidase (PAP, Dako; 1:10000 dilution). Tubulin was detected using mouse-anti-α-tubulin antibody (Sigma-Aldrich T5168 ...
-
bioRxiv - Cell Biology 2020Quote: ... pShuttleCMV-Bub1K795R was used to generate recombinant adenoviruses using the AdEasy system (Stratagene), according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: Recombinant adenoviruses were produced using the AdEasy XL Adenoviral Vector System (Agilent Technologies). The produced adenoviruses were purified using the AdEasy Virus Purification Kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: ... Missense mutations in recombinant proteins were generated by QuikChange site-directed mutagenesis (Agilent) using the respective pET28b derivatives as templates ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant adenoviruses were produced using the AdEasy XL Adenoviral Vector System (Agilent Technologies) and purified using the AdEasy Virus Purification Kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant proteins were expressed in Escherichia coli BL21-CodonPlus (DE3)-RIL cells (Agilent) in LB medium at 16 °C overnight and protein expression was induced by 0.25 mM IPTG (final concentration ...