Labshake search
Citations for Agilent :
1 - 50 of 605 citations for Recombinant Human CD209 Molecule Fc chimera since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... Recombinant human tropomyosin was purified from BL21-CodonPlus (Agilent) using established protocols (91 ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1 μg/mL recombinant anti-PSD95 antibody (Rabbit Fc fusion, NanoTag Biotechnologies #N3783) diluted in Dako REAL Antibody Diluent (S2022, Agilent) for 1 h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... ScFv-Fc were revealed thanks to a polyclonal α-human IgG HRP-conjugated Ab (P0214, Dako), diluted 1:10000 ...
-
bioRxiv - Neuroscience 2019Quote: ... and m-aSyn Chimera N87S were generated via site-directed mutagenesis using the QuikChange method (Stratagene). The sequence of the DNA insert in each bacterial expression construct was verified using an Applied Biosystems (ABI3700 ...
-
bioRxiv - Genetics 2022Quote: The wild-type and mutant BRD-1-BRC-1 chimeras were expressed in BL21-CodonPlus (DE3)-RIPL cells (Agilent). The cells were grown at 37°C until OD600 0.6 and were induced by 0.2mM isopropyl-β-D-thiogalactoside in the presence of 100μM ZnCl2 at 37°C for 6 hrs ...
-
bioRxiv - Systems Biology 2022Quote: ... and mean molecule size was determined with a 2200 TapeStation instrument (Agilent Technologies). Libraries were pooled and paired-end sequenced using an Illumina NextSeq 500 sequencer at a median depth of ∼45,000 reads per cell ...
-
bioRxiv - Neuroscience 2020Quote: ... conversion of both the pre TM1 and the TM2-TM3 loop from the chimera to the corresponding α9 sequence was performed by QuikChange Multi Site-Directed Mutagenesis kit (Stratagene) using primers 5’GGCATGCTCTCGGCCACCATCAGCTGGAAGACGG3’ and 5’GGGCAGCAGGAGGTTGACGATGTAGAATGAAGAGCGGCGCTTCAG3’ ...
-
bioRxiv - Genomics 2020Quote: ... The length of extracted DNA molecules was assessed using a Femto fragment analyser (Agilent). Nanopore genomic DNA libraries were prepared for samples passing quality control using the Ligation Sequencing Kit (Oxford Nanopore Technologies (ONT) ...
-
bioRxiv - Biophysics 2021Quote: ... the double-mutant S11N/G74S variant and the chimera involving the loop [70-77] were introduced using the QuikChange Lighting Site-Directed Mutagenesis kit (Agilent Technologies) and the sequences were confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2022Quote: E382R/S/A mutations were introduced into IgG1 Fc encoded within a pFUSE-hIgG1-Fc vector using site-directed mutagenesis (QuikChange II kit, Agilent), using mutagenic primers (Supplementary Table 4 ...
-
bioRxiv - Genetics 2023Quote: ... A single quadrupole mass spectrometer was used to determine m/z of sample molecules (Agilent, référence 5977B MSD). Molecules were identified using NIST libraries (NIST 2017 Mass Spectral Library).
-
bioRxiv - Biophysics 2022Quote: ... Recombinant plasmids were transformed in XL1Blue (Agilent Technologies) or Top10 (Thermofisher scientific ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... The N322Q mutation was introduced into ACE2-wt-Fc and ACE2-T92Q-Fc using the QuikChange Lightning Site-Directed-Mutagenesis kit (Agilent Technologies, United States) according to the manufacturer’s instructions and the respective parental vector as template ...
-
bioRxiv - Immunology 2021Quote: ... Glycans were isolated and labeled with a fluorescent molecule using a GlykoPrep InstantAB labeling kit (Prozyme, Hayward, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... After performing Fc block by using blocking buffer (Dako, X0909), cells were stained by CD24 (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... immunohistochemical staining was performed using an antibody directed against the mouse endothelial cell surface molecule CD31 (JC70A, DAKO, Glostrup, Denmark). 10 μm-thick cryosections were fixed with 4% PFA solution for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... solution (pH 7.4) and incubated with goat anti-mouse or anti-rabbit immunoglobulin labeled with dextran molecules and horseradish peroxidase (EnVision, Dako) at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... solution (pH 7.4) and incubated with goat anti-mouse or anti-rabbit immunoglobulin labeled with dextran molecules and horseradish peroxidase (EnVision, Dako) at room temperature for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... and a second 1 μl aliquot was used to determine molecule length with an Agilent Genomic Tape (Agilent, Cheadle, UK) on an Agilent TapeStation (Agilent).
-
bioRxiv - Genomics 2023Quote: ... The length distribution of extracted DNA molecules was assessed by electrophoresis on a TapeStation Genomic DNA ScreenTape assay (Agilent Technologies). Single-stranded DNA damage was treated with the NEBNext FFPE DNA Repair mix and repaired DNA was then subjected to size selection to remove fragments shorter than 40 kb using a PippinHT instrument (Sage Science ...
-
bioRxiv - Neuroscience 2024Quote: ... Every fourth section from approximately bregma −1.40 mm to −2.00 mm were immunostained with ionized calcium binding adaptor molecule 1 (Iba1; 1:2000; FUJIFILM Wako) and glial fibrillary acidic protein (GFAP; 1:1000; Dako); 4-6 sections per brain ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA was extracted from four samples using a Qiagen Gentra HMW kit resulting in molecules with a length of mainly > 48 kbp (TapeStation, Agilent Genomics). Further work was carried out by The University of Liverpool’s Centre for Genomic Research ...
-
bioRxiv - Biochemistry 2022Quote: ... The standard used in the analysis consisted of a mixture of glucose polymers ranging from a monomer to a polymer of 16 molecules (glucose1 - glucose16) (ProZyme, Inc.). Oligosaccharide bands in each sample were quantified by comparing the intensity of the glucose4 band (containing 25 pmols) ...
-
bioRxiv - Microbiology 2023Quote: ... Identification of molecules was based on comparison with the metabolic libraries Agilent Fiehn 2013 GC-MS Metabolomics RTL (Agilent Technologies, USA) and the NIST17 Version 2.3 GC Method Retention Index Library ...
-
bioRxiv - Cell Biology 2023Quote: ... solution (pH 7.4) and incubated with goat anti-mouse or anti-rabbit immunoglobulin labeled with dextran molecules and horseradish peroxidase (EnVision, Dako Omnis) at room temperature for 30 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections of human tumors were stained with mouse anti-human CD68 (Dako) and goat anti-human TSP-4 (AF2390 ...
-
bioRxiv - Biochemistry 2023Quote: ... All recombinant plasmids were transformed into XL1-Blue competent cells (Agilent) and sequenced for verification.
-
bioRxiv - Cell Biology 2020Quote: ... incubated with a rabbit antibody against mouse Fc fragment (Dako Agilent Z0412) in PBS 0,1% BSA for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... incubated with a rabbit antibody against mouse Fc fragment (Dako Agilent Z0412) in PBS 0,1% BSA for 20 min at room temperature ...
-
bioRxiv - Systems Biology 2019Quote: ... and human TTR (Dako) with standard curves of purified human RBP4 (72 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human universal RNA (Agilent) was used as a reference to standardise results between QPCR batches.
-
bioRxiv - Microbiology 2021Quote: ... We extracted dissolved organic molecules from the filtrate using solid phase extraction (SPE) with a modified styrene-divinylbenzene polymer (Agilent Bond Elut PPL) as a substrate ...
-
bioRxiv - Genomics 2023Quote: ... The mean size of the library molecules and the quality of the libraries were determined on an Agilent Bio-analyser High Sensitivity DNA chip (Agilent technologies, #5067–4626).
-
bioRxiv - Cancer Biology 2020Quote: ... early and late nascent strands were labeled with Cy3 and Cy5 ULS molecules using the Genomic DNA labeling Kit (Agilent, Santa Clara, CA, USA) following manufacturer's instructions ...
-
bioRxiv - Immunology 2021Quote: ... mouse anti-human CD3 (Dako) and mouse anti-HIV-1 P24 (Dako) ...
-
bioRxiv - Immunology 2021Quote: ... FITC anti-human CD44 (DAKO), Purified NA/LE mouse anti-human CD253 (BD Biosciences) ...
-
bioRxiv - Microbiology 2020Quote: Universal Human Reference RNA (Stratagene) was treated with RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD8 (DAKO), and mouse anti-human TAG72 (AB16838 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD3 (DAKO), mouse anti-human CD4 (DAKO) ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD4 (DAKO), mouse anti-human CD8 (DAKO) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human universal total RNA (Agilent) was used as a positive control ...
-
bioRxiv - Immunology 2023Quote: ... For human CD45 (Dako, M0701), CD19 (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary incubation was performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412), then grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary incubation was performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412), then grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Microbiology 2020Quote: ... ACE2-Fc variants were generated by the QuikChange II site-directed mutagenesis protocol (Agilent).
-
bioRxiv - Immunology 2021Quote: ... washed twice with PBS/2% FCS and stained with PE (Prozyme, 20 µg/ml). RNA flow cytometry measurement of Bhlhe40 expression was performed using the PrimeFlow RNA Assay (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: The library of the extracted genomic DNA was prepared by Illumina Nextera XT DNA Library Prep Kit protocol (# FC-131-1096) and analyzed by Agilent D1000 ScreenTape ...
-
bioRxiv - Cell Biology 2020Quote: ... pShuttleCMV-Bub1K795R was used to generate recombinant adenoviruses using the AdEasy system (Stratagene), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The mGli2-His recombinant protein was expressed in BL21 (DE3) pLysS cells (Stratagene) and purified under denaturing condition (8 M urea ...
-
bioRxiv - Biophysics 2021Quote: Recombinant adenoviruses were produced using the AdEasy XL Adenoviral Vector System (Agilent Technologies). The produced adenoviruses were purified using the AdEasy Virus Purification Kit (Agilent Technologies) ...