Labshake search
Citations for Agilent :
1 - 50 of 6481 citations for Rat Tryptophan 2 3 Dioxygenase TDO2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: 2-methyl tryptophan was quantified by an LC-MS system (Agilent) using an XBridge BEH Amide 2.5 μm (Waters ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Biochemistry 2024Quote: All tryptophan fluorescence assays were performed using a Cary Eclipse fluorimeter (Agilent). Fluorescence emission spectra were collected using 0.5 µM VC0430 in 50 mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Biophysics 2020Quote: Intrinsic tryptophan fluorescence assays were performed on a Cary Eclipse spectrometer (Agilent Inc.) by exciting the samples at 285 nm and monitoring emission from 320 to 400 nm ...
-
bioRxiv - Microbiology 2020Quote: Intrinsic tryptophan fluorescence of recombinant protein was measured using a Cary Eclipse Spectrophotometer (Agilent) and Jasco FP-8500 Spectrofluorometer ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Biophysics 2020Quote: ... Tryptophan fluorescence spectra were then collected on a Cary Eclipse Fluorescence Spectrophotometer (Agilent Scientific, Santa Clara, CA) using an excitation wavelength of 290 nm ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Developmental Biology 2019Quote: ... The following antibodies were incubated overnight at 4°C: rat anti-human CD31 (DAKO, M082329-2), rabbit anti-human S1PR1 (Santa Cruz ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were detected using tryptophan fluorescence (λex=280 nm; λem=315 nm) using a fluorescence detector (Agilent technologies 1200 series, G1321A). The peak heights of the monomeric hsFPN peaks were used to assess the stability by normalizing heights to the corresponding value from samples incubated at 4 °C (100% stability) ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Immunology 2023Quote: ... 2 and the QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cancer Biology 2020Quote: ... which was stirred and allowed to equilibrate for 10 min before the intrinsic tryptophan fluorescence was measured from 300 to 420 nm (λex = 280 nm) on a Cary Eclipse Fluorescence Spectrophotometer (Agilent, Santa Clara, CA). The background corrections in fluorescence changes because of dilution effects with the stepwise addition of ligands were made by buffer titrations ...
-
bioRxiv - Cell Biology 2023Quote: ... Tryptophan fluorescence spectra was then obtained on a Cary Eclipse Fluorescence Spectrophotometer at an excitation wavelength of 280nm (Agilent Scientific, Santa Clara, CA). For all treatments lipid blanks were subtracted.
-
bioRxiv - Developmental Biology 2022Quote: ... Ki67 (rat, DAKO M7249), Fgfr2 (rabbit ...
-
bioRxiv - Pathology 2021Quote: ... rat anti-Ki67 (Dako), mouse anti-γ2pf (Funakoshi) ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-FLAG (Agilent), mouse anti-GFP (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit and Rat respectively (Agilent) for 30 min at RT (anti-SARS-CoV ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... washed in PBS (3 × 5min) and incubated with serum free protein block (Dako, Cat# X090930-2) for 1h at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... Rabbit anti-Rat HRP (Dako #P0450) and Rabbit anti-Mouse HRP(Dako #P0161).
-
bioRxiv - Microbiology 2021Quote: ... polyclonal goat anti-rat IgG (Dako) and polyclonal goat anti-mouse IgG (Sigma) ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... rat α-DYKDDDDK (#200474-21, Agilent) for FLAG signals ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-rat (rabbit, Dako, 1:2000). Image acquisition and result quantification were conducted using Alliance Q9 Advanced Chemiluminescence Imager (UviTech).
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-rat (1/1000, Dako), goat anti-rabbit (1/200 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Ki67 (Rat, 1:500, Dako, M7249) cleaved Caspase3 (Rabbit ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by overnight staining with 1:300 dilutions of rat-anti-C-peptide (DSHB; GN-ID4-S) and mouse-anti-CD31 (Dako; M082329-2) primary antibodies ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... the Quikchange 2 Site-Directed Mutagenesis Kit (Agilent Technologies 210518) was used to introduce the two mutations ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-rat and anti-rabbit antibodies (Dako).
-
bioRxiv - Neuroscience 2023Quote: ... Rat-anti-Ki67 (DakoCytomation, M7249; 1:200); Rabbit-anti-PH3 (Ser10 ...
-
bioRxiv - Pathology 2023Quote: ... rat and rabbit were obtained from DAKO. The secondary antibodies used for immunofluorescence ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG (mouse; Sigma-Aldrich or rat; Agilent), HA (rat ...
-
bioRxiv - Cancer Biology 2019Quote: ... Both the trap (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and the analytical (Agilent Poroshell EC-C18 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Genetics 2020Quote: ... Baseline respiration and maximal respiratory capacity were measured using the Seahorse instrument (XF24 data for Figure 2 and Xe96 data for figure 3) according to manufacturer’s instructions (Agilent). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... For secondary antibody staining, either ImmPRESS kits (anti-goat, MP-7405; anti-rat, MP-7444) or Envision+ Reagents (Dako: rabbit, K4002) were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... the biotinylated rabbit anti-rat secondary antibody (DAKO) was applied ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), rabbit anti-4E-BP1 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), mouse anti-V5 (1:1000 ...