Labshake search
Citations for Agilent :
1 - 50 of 8642 citations for Rat Indoleamine 2 3 Dioxygenase 1 IDO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-rat (rabbit, Dako, 1:2000). Image acquisition and result quantification were conducted using Alliance Q9 Advanced Chemiluminescence Imager (UviTech).
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-rat (1/1000, Dako), goat anti-rabbit (1/200 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Ki67 (Rat, 1:500, Dako, M7249) cleaved Caspase3 (Rabbit ...
-
bioRxiv - Neuroscience 2023Quote: ... Rat-anti-Ki67 (DakoCytomation, M7249; 1:200); Rabbit-anti-PH3 (Ser10 ...
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), rabbit anti-4E-BP1 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), mouse anti-V5 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit-anti-mouse/rat-GFAP (1:3000, Dako), and Mouse-anti-mouse/rat-NeuN (1;200 ...
-
bioRxiv - Microbiology 2021Quote: ... then 1:1500 goat anti-rat IgG-HRP (Dako); anti-histone H4 (Abcam) ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by overnight staining with 1:300 dilutions of rat-anti-C-peptide (DSHB; GN-ID4-S) and mouse-anti-CD31 (Dako; M082329-2) primary antibodies ...
-
bioRxiv - Developmental Biology 2019Quote: ... The following antibodies were incubated overnight at 4°C: rat anti-human CD31 (DAKO, M082329-2), rabbit anti-human S1PR1 (Santa Cruz ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by HRP-conjugated rabbit anti-rat (1:5000, P0450, Dako). For detection of Btn2-HA ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Immunology 2023Quote: ... 2 and the QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cancer Biology 2022Quote: ... Sections were incubated with rat anti-mouse Ki67 (1:50, DAKO #M7249) for 60 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ki67 (rat, DAKO M7249), Fgfr2 (rabbit ...
-
bioRxiv - Pathology 2021Quote: ... rat anti-Ki67 (Dako), mouse anti-γ2pf (Funakoshi) ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-FLAG (Agilent), mouse anti-GFP (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-VWF (A0082, 1:1000) and rabbit anti-VWF-HRP (P0226, 1:8000) used for sandwich ELISA were purchased from Dako, sheep anti-VWF (ab11713 ...
-
bioRxiv - Microbiology 2020Quote: ... an optimal mutation rate (0.3–1 base/kb) for 1µg of template was adopted as recommended in GeneMorph II Random Mutagenesis kit (Agilent Technologies). The PCR products were then digested with EcoRI and HindIII and ligated into the pJF118EH vector using the same restriction enzymes ...
-
bioRxiv - Immunology 2024Quote: ... residues D141 of Regnase-1 and D252 of Regnase-3 were mutated to asparigines using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sections were then stained with polyclonal rabbit anti-rat IgG (1:200, Dako), or EnVision rabbit (Dako ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit and Rat respectively (Agilent) for 30 min at RT (anti-SARS-CoV ...
-
bioRxiv - Genomics 2020Quote: ... 1 - 2 ng / µl was examined using a 2100 Bioanalyzer and a corresponding High Sensitivity DNA Kit (Agilent) to determine the MW profile of the size-selected library ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... washed in PBS (3 × 5min) and incubated with serum free protein block (Dako, Cat# X090930-2) for 1h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-GFAP (1:5000, Dako, Z033401-2), anti-SOX6 (1:2000 ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: ... anti-mouse (Dako P044701-2; 1:1000) Alexa Fluor 488 or anti-rabbit (#1706515 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Rabbit anti-Rat HRP (Dako #P0450) and Rabbit anti-Mouse HRP(Dako #P0161).
-
bioRxiv - Microbiology 2021Quote: ... polyclonal goat anti-rat IgG (Dako) and polyclonal goat anti-mouse IgG (Sigma) ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... rat α-DYKDDDDK (#200474-21, Agilent) for FLAG signals ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...