Labshake search
Citations for Agilent :
1 - 50 of 5617 citations for Rat IL 3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Developmental Biology 2022Quote: ... Ki67 (rat, DAKO M7249), Fgfr2 (rabbit ...
-
bioRxiv - Pathology 2021Quote: ... rat anti-Ki67 (Dako), mouse anti-γ2pf (Funakoshi) ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-FLAG (Agilent), mouse anti-GFP (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit and Rat respectively (Agilent) for 30 min at RT (anti-SARS-CoV ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2019Quote: ... Rabbit anti-Rat HRP (Dako #P0450) and Rabbit anti-Mouse HRP(Dako #P0161).
-
bioRxiv - Microbiology 2021Quote: ... polyclonal goat anti-rat IgG (Dako) and polyclonal goat anti-mouse IgG (Sigma) ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... rat α-DYKDDDDK (#200474-21, Agilent) for FLAG signals ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-rat (rabbit, Dako, 1:2000). Image acquisition and result quantification were conducted using Alliance Q9 Advanced Chemiluminescence Imager (UviTech).
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-rat (1/1000, Dako), goat anti-rabbit (1/200 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Ki67 (Rat, 1:500, Dako, M7249) cleaved Caspase3 (Rabbit ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-rat and anti-rabbit antibodies (Dako).
-
bioRxiv - Neuroscience 2023Quote: ... Rat-anti-Ki67 (DakoCytomation, M7249; 1:200); Rabbit-anti-PH3 (Ser10 ...
-
bioRxiv - Pathology 2023Quote: ... rat and rabbit were obtained from DAKO. The secondary antibodies used for immunofluorescence ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG (mouse; Sigma-Aldrich or rat; Agilent), HA (rat ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Cancer Biology 2022Quote: ... For secondary antibody staining, either ImmPRESS kits (anti-goat, MP-7405; anti-rat, MP-7444) or Envision+ Reagents (Dako: rabbit, K4002) were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... the biotinylated rabbit anti-rat secondary antibody (DAKO) was applied ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), rabbit anti-4E-BP1 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), mouse anti-V5 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit-anti-mouse/rat-GFAP (1:3000, Dako), and Mouse-anti-mouse/rat-NeuN (1;200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Cancer Biology 2024Quote: ... The 3100 OFFGEL Fractionator and the OFFGEL Kit pH 3-10 (Agilent Technologies, Santa Clara, CA) was used following a 24-well set up ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Immunology 2023Quote: ... The plate was then measured using a BioTek ELX808 ELISA reader (Agilent) at 450nm and 620-650nm ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat and rabbit nonimmune IgG (Dako or ThermoFisher Scientific) at the corresponding antibody concentration to verify absence of unspecific antibody binding ...
-
bioRxiv - Immunology 2019Quote: ... Immunoreactions were detected using biotinylated donkey anti-rat (Dako) and goat-anti-rabbit (Vector Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... then 1:1500 goat anti-rat IgG-HRP (Dako); anti-histone H4 (Abcam) ...
-
bioRxiv - Microbiology 2023Quote: ... A rat anti-FLAG mAb was purchased from Agilent Technologies (Santa Clara ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA quality was confirmed as RIN 3 7.5 via Bioanalyzer RNA 6000 Pico kit (Agilent, 5067-1514) and RNA was quantified via Qubit RNA HS Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: Cyanine-3 labeled cRNA was prepared using the One-Color Low input Quick Amp Labeling kit (Agilent). Dye incorporation and cRNA yield was measured with a NanoDrop ND1000 spectrophotometer (Thermofisher) ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Physiology 2019Quote: ... Secondary antibody (horseradish peroxidase coupled rabbit anti-rat IgG, Dako) was diluted 1:2500 in 1% blocking solution and incubated for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-rabbit and anti-rat HRP-conjugated secondary antibodies (Dako). ECL detection was carried out using the Immobilon Crescendo HRP substrate (Millpore ...
-
bioRxiv - Pathology 2023Quote: ... incubated with HRP-conjugated rabbit anti-rat IgG (P0450, Dako) (1:1000 in 1% BSA in TBST) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The rat monoclonal to flag tag (Agilent Cat# 200474, RRID:AB_10597743). The monoclonal to Xenopus laevis Sox3 (DSHB Cat# DA5H6 ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Neuroscience 2022Quote: ... and 3 μM BPTES (Sigma-Aldrich, SML0601) (all XFp Mito Fuel Flex Test Kit, Agilent Technologies 103270-100) according to the manufacturer’s instructions ...