Labshake search
Citations for Agilent :
1 - 50 of 6081 citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR was performed with AccuScript PfuUltra II RT-PCR Kit (600184, Agilent) and a customized RT-primer including unique molecular identifier (UMI ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized with AffinityScript One-Step RT-PCR Kit (Agilent, 600188). Each cDNA sample was amplified in triplicate using the SYBR Green and Platinum Taq polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... A Mx3005p RT-PCR machine (Stratagene) with excitation and emission filters of 492 and 610 nm ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RT-qPCR was performed using the 1-Step Brilliant II SYBR Green quantitative RT-PCR master mix kit (Agilent Technologies) on a Bio-Rad C1000 Thermal Cycler CFX96 Real-Time System ...
-
bioRxiv - Immunology 2020Quote: ... RT-PCR was performed using SybrGreen (Agilent) on the AriaMX (Agilent) ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR reactions were carried out with Stratagene Mx3000P RT-PCR system (Agilent Technologies). Power SYBR™ Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Bioengineering 2022Quote: ... RT-PCR was performed on a SureCyler 8800 (Agilent Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR was performed on AriaMx real-time PCR System (Agilent technologies, USA) with TB Green Premix EX Taq (Takara ...
-
bioRxiv - Immunology 2020Quote: cDNA was synthesized by using the AffinityScript One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, US) using extracted RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Libraries were quantified by quantitative RT-PCR using Agilent qPCR Library Quantification Kit and a MX3005P instrument (Agilent) and relative volumes were pooled accordingly ...
-
bioRxiv - Microbiology 2021Quote: ... HCV RNA was amplified by RT-PCR using Accuscript (Agilent), and specific HCV oligonucleotide primers that have been previously described [Table S10 of (11)] ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-PCR was performed in AriaMx (Agilent Technologies, software v1.0) using SYBR Green PCR Master Mix (iQ SYBR Green ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was performed in an Mx3000P real-time PCR system (Agilent, Santa Clara, CA) using SYBR Premix ExTaq (Takara ...
-
bioRxiv - Microbiology 2020Quote: cDNA was synthesized by using Affinity Script One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA). RNA was mixed with random nonamer primers ...
-
bioRxiv - Neuroscience 2019Quote: ... Extracted RNA genomes were converted to complementary DNA using an AccuScript PfuUltra II RT-PCR kit (Agilent Technologies, USA) at 42°C for 2 hours with the following barcoded primer annealing to the rabies virus leader sequence ...
-
bioRxiv - Biochemistry 2020Quote: ... Quantitative RT-PCR was performed with an Mx3000P qPCR system (Agilent) and analyzed by the MxPro QPCR software (Agilent) ...
-
bioRxiv - Biophysics 2021Quote: Thermofluor assay was performed with a MX3005p RT-PCR instrument (Agilent), SYTO9 (invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative RT-PCR was performed with an Mx3000P qPCR system (Agilent) and analyzed using the MxPro QPCR software (Agilent) ...
-
bioRxiv - Immunology 2024Quote: ... Results were analyzed using the MxPro RT-PCR software (Agilent, USA), and data were expressed as relative mRNA expression = 2−ΔΔCt where ΔCt = Ctunknown – CtHKG and normalized against a house-keeping gene (HKG) ...
-
bioRxiv - Genetics 2022Quote: ... Both the RT-PCR and HRM steps were performed on the ArialMx Real time PCR instrument (Agilent). PCR was performed in 12 μL containing 6 μL Kapa HRM-Fast Master mix (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... Transcripts were quantified using the AccuScript high fidelity RT-PCR system (Agilent) according the manufactures instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Real time RT-PCR was done using Ariamx thermal cycler (Agilent, Germany) with the following parameters ...
-
bioRxiv - Genetics 2022Quote: ... cDNA was amplified using RT-PCR with Brilliant III SYBR Green (Agilent) as per the manufacturer’s instructions using primers ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was amplified using RT-PCR with Brilliant III SYBR Green (Agilent) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... a standard curve was constructed via RT-PCR (Agilent, Santa Clara, CA) with copy numbers of the SIV gene ranging from 4.25 x 109 copies to 85 copies using serial dilutions ...
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR was performed using the AriaMx Real-Time PCR System (Agilent) and the SYBR qPCR Master Mix (ref ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The relative transcript accumulation of NaTPS25 was measured using RT-PCR on a Stratagene MX3005P PCR cycler (Stratagene). The elongation factor-1A gene ...
-
bioRxiv - Microbiology 2020Quote: were performed in triplicate in white 96-well PCR plates (4titude) using a RT-PCR machine (MX3005P, Agilent) with excitation and emission filters of 492 and 585nm ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative RT-PCR was performed using the MX3000p Real-Time PCR System (Agilent Technologies, Santa Clara, CA, USA) to determine the mRNA expression levels of SOS1 ...
-
bioRxiv - Molecular Biology 2019Quote: Relative steady-state levels of specific RNAs by real-time RT-PCR (qRT-PCR) were analyzed using the Brilliant III Ultra Fast SYBR® Green QRT-PCR Mastermix (Agilent, Waldbronn, Germany). Strand-specific analysis was performed as follows ...
-
bioRxiv - Immunology 2020Quote: mRNA in total RNA was converted to cDNAby using AffinityScript One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA) following the method described elsewhere (17) ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time RT-PCR was performed using Mx3005P (Stratagene, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was carried out with SYBR Green PCR master mix (Agilent, 600882) on cDNA (diluted 1:5 in water) ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent Technologies #600886) according to manufacturer’s protocol with 5 ng RNA in 10 µl reactions using 0.5 µM of each primer (Supplementary file 4) ...
-
bioRxiv - Plant Biology 2023Quote: ... The obtained cDNA was used as a template for semiquantitative RT-PCR or Real Time PCR amplification in an AriaMx 1.6 (Agilent). When expression was analyzed using Real Time PCR ...
-
bioRxiv - Bioengineering 2020Quote: One-step Brilliant II RT-qPCR core kit (Agilent) was used for quantitative analysis of extracted HIV RNA ...
-
bioRxiv - Physiology 2020Quote: ... q-RT-PCR was performed using Brilliant III SYBR Green QPCR Master Mix (Agilent) on the StepOne+ Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X Brilliant II qRT-PCR mastermix with 1 uL RT/RNase block (Agilent 600825), and 200 nM forward and reverse primer were used ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative RT-PCR was performed using the Mx3000P QPCR System (Agilent Technologies, Lexington, MA) with incubation parameters of 2 min at 50°C ...
-
bioRxiv - Immunology 2023Quote: RT-PCR product was QC’ed using the DNA high sensitivity Bioanalyzer Chip (Agilent Technologies). Sample preparation for Illumina deep sequencing was done using the KAPA HyperPrep Kit ...
-
bioRxiv - Immunology 2021Quote: cDNA was synthesized from the previously extracted RNA of mice colon tissue by using Affinity Script One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA). RNA was mixed with random 9mer primers ...
-
bioRxiv - Plant Biology 2019Quote: ... was performed by real-time RT-PCR (qRT-PCR) using the BRILLIANT II SYBR® GREEN QPCR Master Mix and the Mx3000P qPCR system (Stratagene, Agilent Technologies Inc. ...
-
bioRxiv - Plant Biology 2019Quote: ... was performed by real-time RT-PCR (qRT-PCR) using the BRILLIANT II SYBR® GREEN QPCR Master Mix and the Mx3000P qPCR system (Stratagene, Agilent Technologies Inc. ...
-
bioRxiv - Genetics 2023Quote: ... Rev: TACTTCCAGCCAACCTCGTGAG) were used to perform Quantitative RT-PCR using the Brilliant II SYBR Green QRT-PCR Master Mix (Agilent # 600825) with the following program ...
-
bioRxiv - Molecular Biology 2021Quote: RT-PCR was performed in a Stratagene™ Mx3005P qPCR instrument (Agilent Technologies, Waldbronn, Germany) using 10 μl QuantiTec SYBR Green PCR mix (Qiagen) ...
-
bioRxiv - Biochemistry 2019Quote: DSF was performed in a 96-well plate using an Mx3005p RT-PCR machine (Stratagene). Each well (20 µl ...
-
bioRxiv - Physiology 2022Quote: ... qPCR analysis was performed using the Stratagene MX3000P RT-PCR System (Stratagene, La Jolla, CA) in a 25-μL reaction mixture ...
-
bioRxiv - Biochemistry 2020Quote: DSF was performed in a 96-well plate using an Mx3005p RT-PCR machine (Stratagene) with excitation and emission filters of 492 and 610 nm ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real-time quantitative PCR (RT-qPCR) was performed using SYBR Green qPCR Master Mix (Agilent) in an ABI 7500 real-time qPCR machine (Life Technologies) ...
-
bioRxiv - Biochemistry 2020Quote: Human ISG15 cDNA was amplified by RT-PCR from universal human reference RNA (Agilent 740000-41), adding BamHI and NotI restriction sites at the 5’ and 3’ ends respectively ...