Labshake search
Citations for Agilent :
1 - 50 of 6471 citations for QuantiFluo Caspase 3 Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... for cleaved Caspase-3 and HRP labeled polymer and DAB chromagen (Dako) for PCNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Staining was performed following the epitope retrieval process using VectaStain Kit from Vector Labs for cleaved Caspase-3 and horseradish peroxidase-labeled polymer from Dako (K4001) for PCNA ...
-
bioRxiv - Cell Biology 2019Quote: Cleaved Caspase-3 staining required 5 minute treatment with Target Retrieval Solution (DAKO S1700), 1 hour room temperature incubation with Cleaved Caspase-3 (Asp175 ...
-
bioRxiv - Cancer Biology 2022Quote: ... slices were then incubated with anti-cleaved caspase 3 antibody or anti-Ki67 antibody (Cell Signalling) and further processed with secondary antibody (LSAB2 horseradish peroxidase kit; Dako, Copenhagen, Denmark).
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Cell Biology 2021Quote: ... All immunostains were performed in Ventana Discovery (Ki-67 and cleaved caspase 3) or Dako autostainers using 3,3’ diaminobenzidine (DAB) chromogen (Dako-Agilent Technologies, Denmark). All slides were scanned using digital slide scanner NanoZoomer-XR C12000 (Hamamatsu ...
-
bioRxiv - Cell Biology 2021Quote: ... All immunostains were performed in Ventana Discovery (Ki-67 and cleaved caspase 3) or Dako autostainers using 3,3’ diaminobenzidine (DAB) chromogen (Dako-Agilent Technologies, Denmark). All slides were scanned using digital slide scanner NanoZoomer-XR C12000 (Hamamatsu ...
-
bioRxiv - Biochemistry 2023Quote: ... (3) RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Cell Biology 2022Quote: ... and RNA Nano Assay kit (Agilent) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... and MycoSensor qPCR Assay Kits (Agilent Technologies) were used to detect mycoplasma contamination ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNA1000 assay kit (Agilent, 5067-1505) respectively ...
-
bioRxiv - Microbiology 2023Quote: For assays run with the Seahorse XF Real-time ATP Rate Assay kit (Agilent), cell growth medium was replaced with assay medium and incubated in a non-CO2 ...
-
bioRxiv - Cancer Biology 2022Quote: Real-time changes in metabolism were tested using a Seahorse XFe96 Analyzer in conjunction with the Seahorse XF Glycolysis Stress Test Assay Kit and the Seahorse XF Real-time ATP Assay Rate Kit (Agilent). Manufacturer instructions were followed to perform each of the assays ...
-
bioRxiv - Neuroscience 2023Quote: ... instrument using the extracellular flux assay kit (Agilent). 20-40 L4 animals were plated in 200µL of M9 per well ...
-
bioRxiv - Molecular Biology 2023Quote: ... and TapeStation High Sensitivity DNA assay kit (Agilent).
-
bioRxiv - Pathology 2022Quote: ... using a kit assay (Agilent RNA 6000 Nano Kit 5067-1511, Agilent).
-
bioRxiv - Pathology 2022Quote: ... using a kit assay (Agilent RNA 6000 Nano Kit 5067-1511, Agilent).
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cancer Biology 2020Quote: Extracellular flux assay kits XF24 (Agilent Technologies, CA, USA) was used to measure oxygen consumption and glycolytic flux ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a Glycolytic Rate Assay Kit (Agilent Technologies: #17394939A) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a Seahorse XF Glycolytic Rate Assay Kit (Agilent) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... and the High Sensitivity DNA Assay kit (Agilent Technologies), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... Seahorse XF Glycolysis Rate Assay Kit (#103344-100, Agilent) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... XFe96 extracellular flux assay kit probes (Seahorse Bioscience 102601-100) were incubated with the included calibration solution overnight at 37°C under non-CO2-injected conditions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with BR Assay kits and a 2100 Bioanalyser platform (Agilent), respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... XFe96 extracellular flux assay kit probes (Seahorse Bioscience 102601-100) were incubated with the included calibration solution overnight at 37°C under non-CO2 injected conditions ...
-
bioRxiv - Cancer Biology 2021Quote: The Seahorse XF Real-Time ATP Rate Assay Kit (Agilent) was used to simultaneously measure the basal ATP production rates from mitochondrial respiration and glycolysis ...
-
bioRxiv - Immunology 2022Quote: ... An XFp real-time ATP rate assay kit (Agilent Technologies) was used following manufacturer’s recommendations and samples were run in a Seahorse XF HS Mini Analyzer (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... XFe96 extracellular flux assay kit probes (Agilent Technologies, 102416-100) incubated with the included manufacturer calibration solution overnight at 37°C without CO2 injection ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Bioanalyzer RNA 6000 Nano assay kit (Agilent, 5067-1511) respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Seahorse XF Real-Time ATP Rate Assay Kit (Agilent), respectively ...
-
bioRxiv - Immunology 2023Quote: ... The XFe96 extracellular flux assay kit (Agilent Technologies, Waldbronn, Germany) was used according to the manufacturer’s protocol with addition of oligomycin ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sensor cartridge from the Extracellular Flux Assay Kit (Agilent) was hydrated in sterile DI water overnight at 37°C in a non-CO2 incubator ...
-
bioRxiv - Genetics 2023Quote: The Seahorse XF Real-Time ATP Rate Assay Kit (Agilent) was used to simultaneously measure the basal ATP production rates from mitochondrial respiration and glycolysis ...
-
bioRxiv - Microbiology 2020Quote: ... Sample quality control was assessed using a Qubit 4 Fluorometer (using Qubit™ dsDNA BR assay Kit) and Agilent 2200 TapeStation (using Agilent D5000 ScreenTape assay kit). Library construction and sequencing was undertaken at Novogene (Beijing ...
-
bioRxiv - Molecular Biology 2021Quote: ... and verified using the Bioanalyzer DNA1000 assay kit (Agilent, 5067-1505). Verified samples were sequenced using the NextSeq 500/550 High Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Bioengineering 2021Quote: ... A mitochondrial stress assay kit (Agilent Technologies, Seahorse XFp, 103010-100) was used to manipulate the mitochondrial respiration and thus the OCR of the cells ...
-
bioRxiv - Cancer Biology 2023Quote: The extracellular flux assay kit XF96 (Agilent Technologies, no.102417-100) was used to measure OCR per manufacturer’s instructions and as previously described [5] ...
-
bioRxiv - Biochemistry 2024Quote: The assay was performed with Agilent Kit 103015-100 (Agilent Technologies), following the same procedures of preparing the sensor cartridge and of cell seeding ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Qubit dsDNA BR Assay Kit and Agilent Genomic DNA ScreenTape (Agilent). The average size of the extracted DNA was estimated to be above 60 kb ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2024Quote: ... The luminescence of caspase was measured with a Synergy H1 microplate reader (Agilent Technologies) and expressed as relative luminescence units (RLU ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... quantified using Qubit HS DNA assay kit and analyzed using a Tapestation D1000 kit (Agilent 5067-5582). Sequencing was performed using Illumina MiSeq with 2 x 250bp reads (University of Cambridge ...
-
bioRxiv - Genomics 2020Quote: ... with either a high sensitivity or normal D5000 ScreenTape assay kit (Agilent) or Fragment analyzer (AATI) ...
-
bioRxiv - Genomics 2019Quote: ... DNA was quantified with Qubit DNA HS assay kit and Bioanalyzer (Agilent) using the DNA High Sensitivity kit ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were analysed using the Seahorse XF Glycolytic Rate Assay Kit (Agilent) with of 0.5 µM rotenone/antimycin A (Rot/AA ...
-
bioRxiv - Plant Biology 2021Quote: ... An RNA Nano 6000 Assay Kit and Bioanalyser 2100 system (Agilent Technologies) were used to assess RNA integrity for RNA-seq analyses ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA High Sensitivity Assay kit on Bioanalyser 2100 (Agilent Technologies, CA, USA) was used for the library quantification and qualification and performed to calculate the mean size of the libraries were 375 base pairs ...