Labshake search
Citations for Agilent :
1 - 50 of 1787 citations for Phospho Src antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were probed with a set of 216 antibodies against total and phospho-proteins using an automated slide stainer Autolink 48 (Dako). Each slide was incubated with one specific primary antibody ...
-
bioRxiv - Neuroscience 2023Quote: Phospho-peptide enrichment was performed in an automated fashion on an AssayMAP Bravo Platform (Agilent Technologies) using AssayMAP FE(III)-NTA cartridges (Agilent Technology) ...
-
bioRxiv - Neuroscience 2022Quote: ... Phospho-null mutation VASP S239A was generated using the QuikChange II Site-Directed Mutagenesis Kit (Cat.#200523, Agilent). Primers were designed using the QuikChange Primer Design Program and obtained from Integrated DNA Technologies IDT ...
-
bioRxiv - Neuroscience 2024Quote: ... The primary incubation was performed overnight at 4°C (phospho-Ser129, BioLegend Cat # 825701, 1:2000; GFAP, DAKO Cat # GA524 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mutagenesis to introduce phospho-site mutations and resistance to Astrin siRNA was performed using the QuikChange method (Agilent Technologies). DNA primers were obtained from Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Mutagenesis to introduce phospho-site mutations and resistance to CDC20 siRNA oligo #14 was performed using the QuikChange method (Agilent Technologies). DNA primers were obtained from Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... or of the phospho FFAT motif (Y768A, T770A, T770D/P771A) were generated using site-directed mutagenesis (QuikChange II XL; Agilent technologies) of EGFP-Miro1 ...
-
bioRxiv - Pathology 2020Quote: ... Antibodies were diluted in antibody diluent (Dako). Immunostained samples were analyzed with a fluorescence microscope (Olympus DP72) ...
-
bioRxiv - Cell Biology 2023Quote: ... primary antibodies prepared in antibody diluent (Agilent) were added for 8 hours at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... All antibodies were diluted in Dako Antibody Diluent (Dako Antibody Diluent S0809; Agilent Technologies). Images were captured by confocal microscopy (Leica DMi8 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were diluted in antibody diluent (Dako) and applied for 45 minutes at room temp ...
-
bioRxiv - Physiology 2022Quote: ... Primary antibodies were diluted in antibody diluent (Dako) and incubated overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies were diluted in Antibody Diluent (Dako) and a droplet of 25 µl or 50 µl applied on the sample for an 8-well or a coverslip upside down ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies were diluted in Antibody Diluent (Dako) and incubated overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... Antibodies were diluted in antibody diluent (Dako, S0809) containing 0.3% Triton X-100 and incubated overnight at 4 °C in a humidified chamber ...
-
bioRxiv - Cancer Biology 2021Quote: Antibodies were diluted in antibody diluent (Dako, S302281-2). Nuclei were visualized by DAPI (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... All antibodies were prepared in antibody diluent from Dako envision kit ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Bioengineering 2021Quote: ... All antibodies were diluted in Dako Antibody Diluent (Dako Antibody Diluent S0809 ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Microbiology 2022Quote: ... primary antibodies and appropriate HRP-conjugated secondary antibodies (DAKO). A chemiluminescence substrate (West Dura ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies were diluted in antibody diluent (Agilent; #S3022) and incubated with sections for 16 hours at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... antibodies were diluted in Background Reducing Antibody Diluent (Agilent) and subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies diluted in antibody diluent (S080983-2, Dako) were applied on sections for overnight at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibody dilutions were prepared in antibody diluent (Agilent, London, UK). The primary antibodies and concentrations used are as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... Antibodies were diluted in Dako Real Antibody Diluent (Dako, S2022). Staining was performed on the BenchMark XT immunostainer (Ventana Medical Systems).
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were diluted in Dako antibody diluent (S0809, Dako) and incubated on sections overnight at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were diluted in Dako antibody diluent (S0809, Dako) and incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: Anti-iba1 microglial antibody (AlphaLaboratories) or anti-GFAP antibody (Agilent) were used with biotinylated polyclonal goat anti-rabbit immunoglobulin secondary antibodies (Dako ...
-
bioRxiv - Cancer Biology 2024Quote: ... primary antibodies were typically diluted in antibody Diluent (DAKO, S2022) with 2% milk (v/v ...
-
bioRxiv - Physiology 2019Quote: ... Secondary antibodies (Dako) anti-mouse ...
-
bioRxiv - Biochemistry 2020Quote: ... Antibodies: Ubiqutin (Dakocytomation); Cdc53/yCul1 (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies (Dako Donkey anti-goat P0449 ...
-
bioRxiv - Developmental Biology 2023Quote: ... CD3 antibody (Dako M725429-2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies were probed using species-specific HRPconjugated secondary antibodies (Dako) and viewed using a Chemidoc imager (BioRad).
-
bioRxiv - Cancer Biology 2022Quote: ... All primary antibodies were diluted with Antibody Diluent (Dako, Hamburg, Germany) and incubated for 1 hour at RT ...
-
bioRxiv - Immunology 2022Quote: ... and rabbit anti-LC3B (1:1000) antibodies in Antibody Diluent (Dako) as primary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... The primary antibody was diluted in antibody diluent (S080983-2, Dako) and applied for 60 minutes at room temperature (RT) ...
-
bioRxiv - Microbiology 2023Quote: ... monoclonal antibody combined with rabbit anti-mouse-HRP polyclonal antibodies (DAKO). Signals were detected by use of enhanced chemiluminescence (ECL ...
-
bioRxiv - Immunology 2023Quote: ... The primary antibodies used were anti-lysozyme antibody (Abcam, and Dako) and Ki67 (Cell Signaling Technology) ...
-
bioRxiv - Cell Biology 2023Quote: ... prior to incubation with antibodies in Dako antibody diluent (Agilent Technologies) overnight at 4°C in a humidified chamber with the following primary antibodies ...
-
bioRxiv - Cell Biology 2024Quote: Secondary antibodies: Peroxidase-conjugated goat anti-mouse IgG antibody (Dako #P0447) (1:2000) ...
-
bioRxiv - Cell Biology 2020Quote: ... prior to incubation with antibodies in Dako antibody diluent (Agilent technologies S3022). Antibodies and the corresponding dilutions used are listed as follows ...
-
bioRxiv - Biochemistry 2019Quote: ... The antibodies used were the polyclonal rabbit anti-human β2M antibody (Dako) (used at 1/1000) ...
-
bioRxiv - Neuroscience 2021Quote: ... All blocking and antibody dilutions were prepared in Dako antibody diluent (Agilent). After three wash steps in TBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Gap43 antibodies were visualized with biotin-conjugated rabbit anti-mouse antibodies (Dako) followed by streptavidin-conjugated Cy3 (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies were detected using biotinylated IgG secondary antibodies (Agilent, 1:400), using streptavidin-HRP (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... The anti-CD8 antibody (1:5,000, C8/144B, mouse monoclonal antibody, Agilent) was detected using the Opal 520 fluorophore (1:150 ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies were detected using horseradish peroxidase (HRP)-conjugated secondary antibodies (Dako) and chemiluminescent reagent (Thermo Scientific) ...