Labshake search
Citations for Agilent :
1 - 50 of 1256 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... using SYBR Green PCR Master Mix II (Agilent Technologies). Amplicons representing target genes and the endogenous housekeeping gene ...
-
bioRxiv - Immunology 2023Quote: ... using qRT-PCR Brilliant II Probe Master Mix (Agilent Technologies) with a TaqMan™ TAMRA Probe system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR Brilliant III ultra-fast master mix kit (Agilent) and TaqMan gene expression probes (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... PCR reactions were performed using Easy-A High-Fidelity PCR master mix (Agilent Technologies, UK) on a Mastercycler Pro Thermal Cycler (Eppendorf ...
-
bioRxiv - Microbiology 2019Quote: ... Both PCR amplifications were carried out using the Paq5000 Hotstart PCR Master Mix (Agilent, USA). The library was sequenced on the MiSeq platform with the MiSeq Reagent V2 250 cycles kit ...
-
bioRxiv - Microbiology 2019Quote: ... For this experiment Brilliant III ultra-fast qRT-PCR master mix (Agilent) was used with ROX following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCR was performed using Brilliant II SYBR Green QPCR Master Mix (Agilent) and a Stratagene Mx3000PQ-PCR machine ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative PCR was performed using Brilliant II SYBR Green QPCR Master Mix (Agilent) and a Stratagene Mx3000PQ-PCR machine ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10µl of Brilliant III Ultra-Fast SYBR® Green PCR Master Mix (Agilent), and finally 25 ng of DNA sample from infected oysters or Milli-Q water (non-template control ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was carried out with SYBR Green PCR master mix (Agilent, 600882) on cDNA (diluted 1:5 in water) ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCRs were realized using SYBR® Green Real-Time PCR Master Mix kit (Agilent Technologies ...
-
bioRxiv - Physiology 2020Quote: ... q-RT-PCR was performed using Brilliant III SYBR Green QPCR Master Mix (Agilent) on the StepOne+ Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... and PCR amplification (PFU Ultra II HS 2x master mix from Agilent, 600850-51) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR amplification was carried out using the Paq5000 Hotstart PCR Master Mix following the manufacturer’s protocol (Agilent, USA). Cycling was performed on an Applied Biosystems Thermal Cycler with cycles consisting of an initial denaturation step at 95°C for 2 min ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent Technologies #600886) according to manufacturer’s protocol with 5 ng RNA in 10 µl reactions using 0.5 µM of each primer (Supplementary file 4) ...
-
bioRxiv - Microbiology 2022Quote: ... The quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative PCR was performed using the 1-Step Brilliant II SYBR Green QRT-PCR Master Mix kit (Agilent Technologies) and the TaqPath 1-Step Multiplex Master Mix kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and PCR was set up with Brilliant II qPCR Low ROX Master Mix (Agilent Technologies). qPCR reaction and data were acquired on an Agilent Mx3005P qPCR System.
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR was performed using the Brilliant II SYBR Green QPCR Master mix (Agilent) in real time PCR (Agilent Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... we used Roche’s LightCycler and Brilliant II SYBR® Green QRT-PCR Master Mix (Agilent).
-
bioRxiv - Microbiology 2022Quote: ... Quantitative qRT-PCR was performed with the Brilliant II SYBR Green QPCR Master Mix (Agilent). Primers were designed to amplify ∼150 bp product within the target genes ...
-
bioRxiv - Neuroscience 2023Quote: qRT-PCR reactions were performed using Brilliant II SYBR Green qPCR Master Mix (Agilent #600828) according to manufacturer instructions using a Light Cycler HT7900 (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real-time quantitative PCR (RT-qPCR) was performed using SYBR Green qPCR Master Mix (Agilent) in an ABI 7500 real-time qPCR machine (Life Technologies) ...
-
bioRxiv - Cancer Biology 2019Quote: ... single strand cDNA synthesis and PCR amplification were carried out in a 1-step reaction using the Brilliant II QRT-PCR Master Mix (Agilent) and TaqMan gene expression assays (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and used as templates for PCR amplification using Brilliant III Ultra-Fast QPCR Master Mix (Agilent) and QuantStudio™ 3 Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Microbiology 2021Quote: ... Real-time quantitative PCR was carried out using the qPCR Brilliant III SYBR Master Mix (Agilent), the primers listed in Table S2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with Brilliant II Ultra-Fast SYBR® Green QPCR Master Mix (Agilent) using a Bio-Rad CFX96 Real-Time Detection System ...
-
bioRxiv - Plant Biology 2019Quote: ... was performed by real-time RT-PCR (qRT-PCR) using the BRILLIANT II SYBR® GREEN QPCR Master Mix and the Mx3000P qPCR system (Stratagene, Agilent Technologies Inc. ...
-
bioRxiv - Plant Biology 2019Quote: ... was performed by real-time RT-PCR (qRT-PCR) using the BRILLIANT II SYBR® GREEN QPCR Master Mix and the Mx3000P qPCR system (Stratagene, Agilent Technologies Inc. ...
-
bioRxiv - Bioengineering 2021Quote: ... Mutations were cloned into the expression vector by polymerase chain reaction (PCR) using a PFUultra II Hotstart PCR Master Mix (Agilent Technologies). The obtained PCR products were subsequently treated with DPNI (New England Biolabs ...
-
bioRxiv - Immunology 2020Quote: ... qRT-PCR for mRNA expression was done with the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent Technologies) as previously described (19) ...
-
bioRxiv - Genetics 2023Quote: ... Rev: TACTTCCAGCCAACCTCGTGAG) were used to perform Quantitative RT-PCR using the Brilliant II SYBR Green QRT-PCR Master Mix (Agilent # 600825) with the following program ...
-
bioRxiv - Cell Biology 2020Quote: ... quantified by performing PCR reaction using Brilliant II SYBR® Green QPCR Master Mix (Agilent Technologies, USA). The primer sequences for PCR analysis were as follows ...
-
bioRxiv - Microbiology 2021Quote: Real-time RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies ...
-
bioRxiv - Genetics 2023Quote: ... Real-time PCR was done in duplicate with Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies) and primers from IDTDna ...
-
bioRxiv - Plant Biology 2021Quote: ... using SYBR Green qPCR master Mix (Agilent) and gene-specific oligonucleotides (Table S5 ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-C1-tubbyCT KR330/332AA was generated by mutagenesis PCR using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies, Santa Clara, US).
-
bioRxiv - Microbiology 2020Quote: ... qRT-PCR reactions contained 10 μL of 2×Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent), 2 μL of each 2 μM primers (Table S5) ...
-
bioRxiv - Plant Biology 2022Quote: ... real-time PCR system with the Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technology Inc, Waldbronn, Germany).
-
bioRxiv - Systems Biology 2022Quote: Target cDNAs were measured by quantitative PCR with Brilliant III Ultra-Fast SYBR Green qPCR master mix (Agilent) using a Lightcycler 480 qPCR machine (Roche) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of the HMPV N gene was performed by quantitative PCR using SYBR Green qPCR Master Mix (Agilent) and a set of primers listed in Table 1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Aria Mx real time PCR system with the Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies) was used to quantify the transcript levels ...
-
bioRxiv - Genetics 2021Quote: ... Real-time PCR reactions were performed with the Brilliant II SYBR® Green QPCR Master Mix (Agilent, 600828). The relative quantification in gene expression was carried out using the 2- ΔΔCt method (51) ...
-
bioRxiv - Cell Biology 2023Quote: ... Von Zastrow lab).The DNA fragments were amplified by Pfu Ultra II Hotstart PCR master mix (Agilent Technologies) and ligated with each respective vector by NEBbuilder HiFi DNA assembly master mix (New England BioLabs).
-
bioRxiv - Microbiology 2024Quote: ... 10-µl reactions were prepared with the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent) in technical duplicates for each sample ...
-
bioRxiv - Cell Biology 2019Quote: ... was then performed with SYBR Green 2x Master Mix (Applied Biosciences) or Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent) utilizing the EPA1qPCR F and EPA1qPCR R primer set to amplify the EPA1 amplicon ...
-
bioRxiv - Immunology 2020Quote: ... with a Brilliant III SYBR master mix (Agilent) and specific primer pairs ...
-
bioRxiv - Immunology 2022Quote: ... master mix on a Mx3005P System (Agilent Technologies). Each assay was run in triplicate using 15µl of reaction mix containing 7.5ul Brilliant III Ultra-Fast SYBR Green (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... Brilliant II SYBR Green QPCR master mix (Agilent) was used to make the reaction mix ...