Labshake search
Citations for Agilent :
1 - 50 of 6877 citations for Mouse N Myc Proto Oncogene Protein MYCN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... HRP-labelled goat anti-mouse immunoglobulin (cat. n° P0447, Dako). The following antibodies were used for flow cytometry ...
-
bioRxiv - Cell Biology 2021Quote: ... was then mutated to either R to mimic deacetylated c-Myc (K323R) or Q to mimic acetylated c-Myc (K323Q) using QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, 200522-5) against pPHAGE-EF1α-HA-Puro-c-Myc ...
-
bioRxiv - Microbiology 2022Quote: ... HRP-labelled goat anti-mouse immunoglobulin (IgG; cat. n° P0447, Dako). The following antibodies were used for flow cytometry ...
-
bioRxiv - Cell Biology 2023Quote: GFP-TRIM5α and myc-TBK1 were mutated using a site-directed mutagenesis kit (Agilent, 210518). All plasmid constructs generated in this study were validated by DNA sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... Myc-TRIM27 W184A/F186A/L189A was mutated with Quickchange II site-directed mutagenesis kit (Agilent). pDONR221-AZI2/NAP1 was synthesized by Invitrogen GeneArt services (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1:1000, ab183741, abcam; n-Myc: 1:500, 51705 Cell Signaling Technology; CD45: 1:1000, 70257 Cell Signaling Technology; CD3: 1:2000 A0452 Dako/Agilent) diluted in TBST+5% goat serum in a humid chamber overnight at 4°C ...
-
bioRxiv - Biophysics 2021Quote: hnRNPA1* (where * denotes that the hexa-peptide 259-264 is deleted) protein and deletion constructs were expressed as N-terminally tagged hSUMO fusion proteins in BL21 (DE3) RIPL cells (Agilent) in LB media ...
-
bioRxiv - Cell Biology 2020Quote: The Bub1 K795R allele was generated by a single-base substitution in full-length mouse Bub1 cDNA cloned into pcDNA3/Myc using site-directed mutagenesis (Stratagene), then subcloned into a pShuttleCMV vector as a BglII-NotI digest ...
-
bioRxiv - Cancer Biology 2020Quote: ... MYC/8q24 (probe Y5410; DAKO A/S), and PDL1/9p24.1 (PDL1 ...
-
bioRxiv - Immunology 2022Quote: ... Myc-NEU3 mutants were generated using a QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA) with the DNA oligomers GGGCCCCTTAAACCACTTATTGAATCCACACTACC for mutant 1 and CAGTTCACTTAGACTGGAAGATGAATCTGGAACAC for mutant 2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pEF-MYC RAF1 S471A was made using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies), Forward Primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Rabbit-Mouse kit (Dako, Denmark). Sections were counterstained with haematoxylin (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Rabbit-Mouse kit (Dako, DK). Sections were counterstained with haematoxylin (Sigma-Aldrich Inc.) ...
-
bioRxiv - Neuroscience 2021Quote: ... and the quality of the libraries were performed on a 2100 Bioanalyzer from Agilent using an Agilent High Sensitivity DNA kit (Agilent P/N 5067-4626). Sequencing libraries were loaded at 10 to 12pM on an Illumina HiSeq2500 with 2 × 50 paired-end kits using the following read length ...
-
bioRxiv - Cancer Biology 2023Quote: ... N-Universal Negative Control Anti-Rabbit or Anti-Mouse (IS600 and IS750, respectively, Dako, Glostrup, Denmark) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit, Agilent, 210515) to create PLCγ2-P522R-myc-DDK (P522R ...
-
bioRxiv - Biochemistry 2020Quote: Skd3 variants were expressed as an N-terminally MBP-tagged protein in BL21 (DE3) RIL cells (Agilent). Cells were lysed via sonication in 40mM HEPES-KOH pH=7.4 ...
-
bioRxiv - Cell Biology 2020Quote: ... Myc-CUL5-ΔNEDD8 (K724A/K727A/K728A) mutant was obtained using QuickChange Multi Site-Directed Mutagenesis kit from Agilent (#200514) using the primer shown in Table S5 ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by horseradish peroxidase (HRP)-conjugated anti-mouse antibodies (Cat. N. P044701-2, Agilent Technologies LTD, Cheadle, UK) (2.4μg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... The pcDNA3.1 ERG (GenBank accession. NM_182918) Myc-tagged construct was mutated using the QuickChange Lightning Multi SiteDirected Mutagenesis kit (Agilent: #210513). All primers were designed using the QuickChange Primer Design Program (Agilent ...
-
bioRxiv - Biochemistry 2020Quote: Nhp6 was expressed as a N-terminal 6x His-tag fusion protein in E.coli BL21-CodonPlus (DE3)-RIL cells (Agilent). A colony of cells freshly transformed with plasmid p1035 was grown in 3 L of LB supplemented with 50 μg/mL ampicillin and 34 μg/mL chloramphenicol at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... The plasmid encoding the protein fused with a His-tag at the N-terminus was transformed in BL21 DE3 pLysS strains (Agilent). Recombinant αE-catenin was expressed via isopropyl 1-thio-β-d-galactopyranoside (IPTG,Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: Two different glycosidases were used for specific removal of N-glycans: peptide N-glycosidase F (PNGase F) and endo N-glycosidase H (Endo H) (Prozyme, Hayward, CA). PNGase F removes all N-glycans from gp120/41 glycoprotein whereas Endo H removes high-mannose and hybrid glycans ...
-
bioRxiv - Immunology 2020Quote: ... and isotype control: Glycans were prepared using the GlykoPrep® Rapid N-Glycan Preparation kit (PROzyme) and separated by Hydrophilic-Interaction Liquid Chromatography (HILIC ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: Mutagenesis of His 359 and Glu 363 to Alanine in human MYC (MycHEA mutant) was performed using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies # 200519), according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: Both mutants K465A and R466A/K467A of human PDK1 were obtained by site-directed mutagenesis of the eGFP-myc-PDK1 and HA-PDK1-mCherry constructs [13] with the QuickChange mutagenesis kit (Agilent Technologies, Inc.). The oligos used for the mutagenesis were as follows ...
-
bioRxiv - Pathology 2020Quote: ... Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Microbiology 2024Quote: ... and mouse myelin basic protein antibody (anti-MBP, 1:500, Dako, Glostrup, Denmark), respectively for 24 hours at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with 50 µl/well of HRP-conjugated rabbit anti-mouse total IgG (1:1,000 in ELISA dilution buffer; P0260, Dako Agilent, Santa Clara, CA, USA), goat-anti-mouse IgG1 (1:8,000 in ELISA dilution buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Pathology 2020Quote: ... Abcam, Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Cell Biology 2022Quote: ... were introduced into the plasmid pED-FLAG-LMAN1 and pcDNA-MCFD2-Myc separately using the QuickChange site-directed mutagenesis II XL kit from Agilent (Santa Clara, CA). FVIII mutant constructs Δ807–816 (deletion of amino acids 807-816 of FVIII ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with 50 µl/well of HRP-conjugated rabbit anti-mouse total IgG (1:1,000 in ELISA dilution buffer; P0260, Dako Agilent, Santa Clara, CA, USA), goat-anti-mouse IgG1 (1:8,000 in ELISA dilution buffer ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2021Quote: ... A secondary quantification measurement with Bioanalyzer Protein Analysis Kits (Agilent) provided similar concentration values as SYPRO Red assay (data not shown).
-
bioRxiv - Cancer Biology 2023Quote: ... Protein expression was visualised using DAB (Dako Real Envision kit) for 3-5 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... and SureSelectXT Mouse Methyl-Seq Reagent Kit (Agilent Catalog # 931052) ...
-
bioRxiv - Molecular Biology 2022Quote: ... or Dako EnVision + TM Peroxidase Mouse Kit (DAKO, Glostrup, Denmark) with 3,3’-diaminobenzidine as substrate ...
-
bioRxiv - Biophysics 2022Quote: ... a N-STORM 647 nm laser (Agilent), an iXon 897 Ultra EMCCD (Andor Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.4 (Agilent, cat. n. 103575-100). The assay medium only was used as a blank in one well coated with dH2O and one well with Cell-Tak.
-
bioRxiv - Bioengineering 2023Quote: ... 4.6 × 300mm (Agilent, P/N: PL1580-5301) SEC column connected to Agilent 1260 Bioinert Infinity Quaternary Pump System (Pump serial# DEAGH00678) ...
-
bioRxiv - Genomics 2020Quote: ... As described in manufacturer’s protocol (Agilent SureSelectXT Mouse Methyl-Seq Kit), bisulfite converted libraries were PCR-amplified for 8 cycles with supplied universal primers and purified using AMPure XP beads ...
-
bioRxiv - Neuroscience 2022Quote: ... and the Dako Envision Flex Plus Mouse Link Kit (Agilent, USA) to detect the antibody along with the Dako DAB (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... and the Dako Envision Flex Plus Mouse Link Kit (Agilent, USA) to detect the antibody along with the Dako DAB (Agilent ...
-
bioRxiv - Neuroscience 2021Quote: ... TDP-43N-Del was generated by deletion of the first 81 amino acids from the N-terminus of TDP-43WT using the QuickChange Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Biochemistry 2019Quote: ... vector encoding the pG gene as reported previously26 was site-specifically mutated by the insertion of an N-terminal serine using the QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent), according to the manufacturer’s instructions using following forward and reverse primers (ser codon underlined) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6XHis tag was added to the N-terminus of Upf1 in pGEM-3Zf (+) using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) with oligonucleotides 5-N-His-UPF1 and 5-N-HIS-UPF1-r to yield pGEM3Zf(+)-6XHis-UPF1 ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1zeo+/ nFlag-cmScarlet-hRobo1 was generated by inserting the Flag tag sequence at the N-terminus after the signal peptide sequence of Robo1 with QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Bioengineering 2019Quote: N-linked glycans were released from purified antibody samples by overnight incubation with N-Glyccosidase F (Prozyme, GKE-5006B). The proteins were removed using LudgerClean glycan EB-10 cartridges (Ludger ...
-
bioRxiv - Cell Biology 2021Quote: ... NDE1 and RASAL2 were PCR-cloned into pCMV2B (Flag) and pCMV3B (Myc) constructs (Stratagene). Expression constructs for SCRIBBLE ...