Labshake search
Citations for Agilent :
1 - 50 of 6839 citations for Mouse Histone H3.3C H3 5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and histone H3 isolated by HPLC (Agilent Technologies 1200 series) using a Luna 5 μm CN 100Å HPLC column (Phenomenex ...
-
bioRxiv - Cell Biology 2019Quote: ... H3 S10A and H3 S10E using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent technologies, cat#200521) according to manufacturer’s instruction ...
-
bioRxiv - Genetics 2023Quote: ... we inserted a wild-type histone array sequence containing the 5 replication-dependent histone genes into a pBluescript II KS+ vector (Agilent #212207) and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5% mouse serum (Agilent, Germany). Positive cells were isolated with the micromanipulator and subjected to whole genome amplification.
-
bioRxiv - Cell Biology 2023Quote: ... and Rabbit Anti-Mouse (Dako P044701-5) secondary antibodies were purchased from Agilent ...
-
bioRxiv - Immunology 2019Quote: ... MG505.A3 or MG505.H3) was altered by site-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Rabbit-Mouse kit (Dako, Denmark). Sections were counterstained with haematoxylin (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Rabbit-Mouse kit (Dako, DK). Sections were counterstained with haematoxylin (Sigma-Aldrich Inc.) ...
-
bioRxiv - Neuroscience 2024Quote: ... or 27 into methionine on histone H3.3A using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies #200521) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523-5) was used for mutagensis of GFP-VPS35L constructs following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with 50 µl/well of HRP-conjugated rabbit anti-mouse total IgG (1:1,000 in ELISA dilution buffer; P0260, Dako Agilent, Santa Clara, CA, USA), goat-anti-mouse IgG1 (1:8,000 in ELISA dilution buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Bacteria for histone expression were BL21(DE3)pLysS and BL21(DE3) cells (Agilent). Transformed bacteria were grown on 2xTY media (1.6% Bacto Tryptone ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with 50 µl/well of HRP-conjugated rabbit anti-mouse total IgG (1:1,000 in ELISA dilution buffer; P0260, Dako Agilent, Santa Clara, CA, USA), goat-anti-mouse IgG1 (1:8,000 in ELISA dilution buffer ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... These histones were co-expressed in Escherichia coli strain BL21-codonplus-DE3-RIL (Agilent), and the histone octamer with the K120>C mutation in histone H2A was purified according to Ref33 ...
-
bioRxiv - Cell Biology 2022Quote: ... and SureSelectXT Mouse Methyl-Seq Reagent Kit (Agilent Catalog # 931052) ...
-
bioRxiv - Molecular Biology 2022Quote: ... or Dako EnVision + TM Peroxidase Mouse Kit (DAKO, Glostrup, Denmark) with 3,3’-diaminobenzidine as substrate ...
-
bioRxiv - Immunology 2019Quote: ... Antibodies used for paraffin immunostaining were: rat anti-mouse Ki67 monoclonal antibody (MIB-5, Dako) and rabbit anti-mouse Yap1 antibody (D8H1X ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were washed with TBS-Tween 0.05% for 5 min and rabbit/mouse link (Agilent) was added to slides and incubated for 15 min at room temperature in the dark ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Genomics 2020Quote: ... As described in manufacturer’s protocol (Agilent SureSelectXT Mouse Methyl-Seq Kit), bisulfite converted libraries were PCR-amplified for 8 cycles with supplied universal primers and purified using AMPure XP beads ...
-
bioRxiv - Neuroscience 2022Quote: ... and the Dako Envision Flex Plus Mouse Link Kit (Agilent, USA) to detect the antibody along with the Dako DAB (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... and the Dako Envision Flex Plus Mouse Link Kit (Agilent, USA) to detect the antibody along with the Dako DAB (Agilent ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2021Quote: ... Site-Directed Mutagenesis using the QuikChange II XL kit (Agilent, #200522-5) was performed and the mutations were confirmed by sanger sequencing ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Individual point mutations of wt TatABC or H3 were introduced using Quik-change site-directed mutagenesis (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... One microgram or more of mouse genomic DNA from each sample was analyzed by whole exome sequencing using the SureSelectXT Mouse All Exon kit (Agilent), followed by next generation sequencing using the NovaSeq 6000 S4 flow cell (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Dako Animal Research Kit for mouse primary antibodies (Dako Diagnóstico S.A., Spain) was used for the qualitative identification of antigens by light microscopy ...
-
bioRxiv - Immunology 2019Quote: ... The sections were incubated in the kit polymer-HRP anti-mouse (Dako En Vision+ System-HRP ...
-
bioRxiv - Biophysics 2019Quote: ... Histone expression plasmids were from Narlikar lab and BL21(DE3)pLysS competent E.coli cells were from Agilent Technology (USA) ...
-
bioRxiv - Genetics 2023Quote: ... Transcriptional profiling was performed on mouse colon samples using the SurePrint G3 Mouse GE8×60K Microarray kit (design ID:028005, Agilent Technologies). Cyanine-3 (Cy3)-labeled cRNAs were prepared with 100ng of total RNA using a One-Color Low Input Quick Amp Labeling kit (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Whole exome sequencing (WES) was performed using the Mouse All Exon kit (Agilent) for target capture followed by next-generation sequencing by Psomagen ...
-
bioRxiv - Microbiology 2020Quote: ... The codon at amino acid position 160 in HA (H3 numbering, Threonine) was modified via site-directed mutagenesis (Agilent) from the wild type (ACA ...
-
bioRxiv - Immunology 2023Quote: ... The plate was then measured using a BioTek ELX808 ELISA reader (Agilent) at 450nm and 620-650nm ...
-
bioRxiv - Biophysics 2020Quote: ... After rinsing for 5 minutes in PBS they were incubated with secondary antibody (Rabbit Anti-Mouse 1/200, Dako) for 30 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... rabbit/mouse following manufacturer’s instructions (Detection Kit #K5005, Agilent Technologies, Santa Clara, CA, USA). Immunostained tissue sections were counterstained with hematoxylin solution according to Mayer (T865.1 ...
-
bioRxiv - Immunology 2020Quote: Whole-exome sequencing libraries were constructed using the SureSelect Mouse all Exon Kit (Agilent). RNA sequencing libraries were constructed using the TrueSeq Stranded mRNA Sample Prep kit (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the sections were incubated in HRP rabbit/mouse secondary antibody (DAKO Real EnVision kit) for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from mouse lungs using the Absolutely Total RNA Purification Kit (Agilent). RNA extraction from cell culture experiments were performed using the Qiagen RNeasy kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 30 min or with 0.4 µg/ml anti-human cath-D mouse monoclonal antibody (clone C-5) for 20 min after heat-induced antigen retrieval with the PTLink pre-treatment (Dako) and the High pH Buffer (Dako ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The hybridization was performed according to the manufacturer instructions on 4×180K mouse microarrays (SurePrint G3 Mouse CGH Microarray Kit, 4x180K, AGILENT Technologies, reference genome: mm9). Microarrays were scanned with an Agilent High-Resolution C Scanner using a resolution of 3 µm and the autofocus option ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were prepared according to Illumina’s instructions and SureSelectXT Mouse All Exon enrichment kits (Agilent) were used ...
-
bioRxiv - Cell Biology 2019Quote: RNA was extracted from mouse embryonic stem cells using the Absolutely RNA microprep kit (Agilent). 1 µg of RNA was pre-incubated with 4.5 µg of (PR)20 or water for 10 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... exome capture was performed using the Agilent SureSelect Mouse All Exome QXT capture kit (Agilent). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further three times with TBS-T for 5 minutes and stained with DAKO EnVision-HRP rabbit/mouse (Agilent; #K5007) for 2 hours at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...