Labshake search
Citations for Agilent :
1 - 50 of 3804 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Sections were coverslipped using Di-N-Butyle Phthalate in xylene (DPX, Dako).
-
bioRxiv - Developmental Biology 2023Quote: ... the beads were transferred into a 1-mL PP filtration microplate (Agilent, 7 µm frit, cat. no. 202501-100) and washed 3x with 200 µL 1x PBS and 2x 200 µL ultrapure water ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Neuroscience 2021Quote: ... 25 and 50 ppb with Sc-45 (ICP-MS internal standard mix 1 ug/mL in 2% HNO3, Agilent Technologies) as the internal standard for Cu-63.
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-matched primary tumor tissues and PDTOs were immunostained for diagnostic NSCLC markers with antibodies against cytokeratin (CK)7 (mouse, M7018, 1:100; Dako), CK5/6 (mouse ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Cell Biology 2023Quote: ... freshly prepared) was flowed at 1 ml/min through a 1:100 flow splitter (Agilent Technologies 1260 Infinity II ...
-
bioRxiv - Physiology 2023Quote: ... freshly prepared) was flowed at 1 ml/min through a 1:100 flow splitter (Agilent Technologies 1260 Infinity II ...
-
bioRxiv - Plant Biology 2023Quote: ... an anion-exchange cartridge (Bond Elut DEA 100 mg/1 mL, Agilent), and a silica cartridge (Sep-Pak Silica 1 cc Vac Cartridge ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were then incubated with primary antibodies for 48 h at 4°C (AXIN2 1:100, FZD1 1:100, LEF1 1:100, AQP1 1:100, OTX2 1:50, β-Catenin cell signaling 1:400, β-Catenin Dako 1:200), washed and subsequently incubated with secondary anti-mouse or anti-rabbit antibodies diluted in PBS (at 1:1000 ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 ml samples were injected with a split ratio of 7:1 into an Agilent GC-MS system (Agilent Inc, Palo Alto, CA) consisting of an 7890A gas chromatograph ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Biophysics 2019Quote: ... while labeled and unlabeled peptide were separated by reverse-phase HPLC (Agilent, Santa Clara, CA). The purity of the conjugations was confirmed by MALDI-TOF (Bruker ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Genetics 2020Quote: ... Captured libraries were amplified in 3×100 μl reactions containing 1 unit Herculase II Fusion DNA polymerase (Agilent), 1x Herculase II reaction buffer ...
-
bioRxiv - Physiology 2023Quote: ... and the mitochondria are resuspended in 1 mL of Seahorse medium (Agilent #103335-100) with supplemented 10 µL of 5 mM pyruvate (Sigma #P2256-100G ...
-
bioRxiv - Physiology 2023Quote: ... and the mitochondria are resuspended in 1 mL of Seahorse medium (Agilent #103335–100) with supplemented 5 mM pyruvate (Sigma #P2256-100G) ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Physiology 2023Quote: ... freshly prepared) was flowed at 1 ml/min through a 1:100 flow splitter (1260 Infinity II; Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Pathology 2023Quote: ... SMMS-1 (M3558, Dako, 1:100) and PG-M1 (M0876 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Labelled radioactive peptide was separated from unlabeled peptide by HPLC purification (Agilent ZORBAX 300 Extend-C18 column) using a gradient from 20-50% acetonitrile (+0.1 % TFA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Labelled radioactive peptide was separated from unlabeled peptide by HPLC purification (Agilent ZORBAX 300 Extend-C18 column) using a gradient from 20-50% acetonitrile (+0.1 % TFA ...
-
bioRxiv - Cell Biology 2021Quote: ... MyoD (1:100, Dako) and Myogenin-concentrate (1:10 ...
-
bioRxiv - Plant Biology 2022Quote: ... a Poroshell 120 SB C18 column (3 × 100 mm, 2.7 μm, 4.6 × 100 mm, Agilent, Palo Alto, USA) was utilized during the analysis ...
-
bioRxiv - Pathology 2023Quote: ... Antigen retrieval was carried out using Proteinase K (5 μg/ml, 7 mins, Dako, UK). Sections were rinsed in running tap water for 5 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples of labeled and unlabeled antibody (5 – 10 μg) were run on a HPLC (Agilent 1260 Infinity II) using an Agilent AdvanceBIO SEC 300Å 2.7 mm column (PL1580-3301 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat. no. 103575-100) supplemented with 10mM glucose (Agilent cat ...
-
bioRxiv - Bioengineering 2019Quote: ... S-100 (1:250, Dako), and/or (v ...
-
bioRxiv - Genomics 2020Quote: ... CD68 (1:100, KP1, Dako), Fibronectin (1:100 ...
-
bioRxiv - Neuroscience 2020Quote: ... CD31 (1:100, mouse, Dako), Podocalyxin (1:200 ...
-
bioRxiv - Developmental Biology 2022Quote: ... PECAM (1:100, Dako, M0823). The next day ...
-
bioRxiv - Cell Biology 2022Quote: ... MYOD1 (Dako, M3512; 1:100), MYOG (DSHB ...
-
bioRxiv - Physiology 2024Quote: ... and GFAP (1:100; Dako). Slides were washed with TBS and incubated for 1 h in the dark with AlexaFluor 555 or 647 (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 pyruvate (Agilent #103578-100), 2 glutamine (Agilent #103579-100 ...
-
bioRxiv - Biophysics 2020Quote: ... Optical absorption spectra of the samples in a 300-900 nm range were recorded within about 10 s at given time intervals (about 0.3-1.0 min) in a 3 mL quartz cuvette (Helma QS1000, 1 cm pathlength) using a Cary 60 spectrometer (Agilent). Alternatively ...
-
bioRxiv - Neuroscience 2022Quote: ... The certificate of analysis attested to a 100% radiochemical purity on the basis that 99.68% of radiolabeled material co-eluted with the unlabeled reference standard on a Zorbax SX 4.6 x 250 mm column (catalog number 959990-912, Agilent Technologies Canada ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed with Bond Wash buffer 3 x 30s and then incubated with either mouse anti-CD68 (M0814, 1:100, Dako, Carpenteria, CA), mouse anti-βIII-Tubulin (G7121 ...
-
bioRxiv - Pathology 2020Quote: ... and Ki-67 (1:100, MIB-1, Dako) in an Autostainer Link48 automated staining platform (Dako ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-Ki67 (Dako, MIB-1, 1:100), mouse anti-DLX2 (Santa Cruz ...
-
bioRxiv - Microbiology 2021Quote: ... Two ug of tryptic digested Mars-14 (Agilent, Santa Clara, CA) depleted serum were eluted from a high-capacity nano-HPLC Chip (160 nL ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were washed 3 times with 100 µL of XF Base Media (Seahorse Bioscience) containing 2 mM L-Glutamine ...
-
bioRxiv - Biochemistry 2021Quote: The fluorophore-labeled single-stranded DNA oligonucleotide was separated from unlabeled oligonucleotide and unincorporated free fluorophore by C18 reverse-phase HPLC chromatography (Poroshell 120 EC-C18, Agilent). Labeled fractions were pooled and ethanol precipitated as described above and resuspended in aqueous solution (10mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Genomics 2020Quote: ... CD8 (1:100, C8/144B, Dako), CD68 (1:100 ...
-
bioRxiv - Immunology 2022Quote: ... 1 mM pyruvate (103578-100; Agilent), and 2 mM L-glutamine (103579-100 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-KI67 (DAKO, M7240, 1:100), anti-PAX6 (BioLegend ...
-
bioRxiv - Cancer Biology 2020Quote: ... S100 (Cat#Z0311, Dako, 1:100). Subsequently ...