Labshake search
Citations for Agilent :
1 - 50 of 6410 citations for Medium Kit without Serum and with CultureBoost R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... The plate was washed again with medium without serum and analyzed using the Seahorse XFp apparatus (Agilent). The final concentrations of the injected compounds were the following ...
-
bioRxiv - Physiology 2024Quote: ... Assay medium consisted of Sea Horse XF base medium without phenol red (Agilent Technologies, Cat#103335-100) supplemented with glucose (25 mM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Seahorse XF DMEM medium (without Phenol Red/pH 7.4/with HEPES/500 mL, Agilent, Cat# 103575-100) to quantify Oxygen Consumption Rate (OCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Seahorse XF DMEM medium (without Phenol Red/pH 7.4/with HEPES/500 mL, Agilent, Cat# 103575-100) to quantify oxygen consumption rate (OCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were incubated in 500 µL Seahorse XF Base Medium Minimal DMEM without Phenol Red (Agilent, 103335-100) 1 h at 37 °C in CO2 free-atmosphere ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were washed twice with serum-free XF DMEM medium (Agilent Technologies ...
-
bioRxiv - Genetics 2021Quote: ... followed by incubation with 525 ml of assay medium at 37°C in an incubator without CO2 (Agilent Technologies) for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... After two hours incubation in blocking medium containing 10% goat serum (Dako), 1% BSA (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... Seahorse XF base media without phenol red and Mito Stress Kits were from Agilent (Santa Clare, USA). All other chemicals including palmitate and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide ...
-
bioRxiv - Cell Biology 2022Quote: ... Medium was changed 1-hour before the start of readout into 180 μL serum-free assay medium (Agilent Seahorse XF DMEM; 103575-100) supplemented with 4mM L-glutamine (Corning ...
-
bioRxiv - Cell Biology 2022Quote: ... T cell culture medium was changed 1 hour before the start of readout into 180μL serum-free assay medium (Agilent Seahorse XF DMEM; 103575-100) supplemented with 4mM L-glutamine ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were blocked with 5 μg/ml human immunoglobulins solved in blocking serum-free medium (Dako) for 30 minutes ...
-
bioRxiv - Genetics 2022Quote: ... This variant was deemed a SNP without functional consequences but subsequently corrected and other missense variants were generated by QuickChange Multi Site-Directed Mutagenesis Kit (Agilent). WT and missense variant cDNAs were transferred from pDONR223 to MSCV_IP_N terminal-HA-FLAG vector using Gateway recombination (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... Prior to conjugation, R-Phycoerythrin (R-PE, 240kDa) (Prozyme, Hayward, CA) was extensively dialyzed into phosphate-buffered saline (PBS ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis of the human l/r-pyk gene was performed with a QuikChange kit (Stratagene). Proteins were expressed in the FF50 strain of Escherichia coli 8 that has both native E ...
-
bioRxiv - Cell Biology 2019Quote: ... K-R mutant plasmids were generated using Quikchange II XL site-directed mutagenesis kit (Agilent), with primers listed in Table S5 ...
-
bioRxiv - Biophysics 2021Quote: ... The MutL (R-E) mutation was generated using the QuikChange site-directed mutagenesis kit (Stratagene). Two serine residues separated the his6 and srt ...
-
bioRxiv - Microbiology 2023Quote: ... AIP56D274S/D276-278S and AIP56D274N/D276-278N with or without V5-tag were generated with the QuickChange Site-Directed Mutagenesis Kit (Stratagene, 200518) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Immunology 2024Quote: ... or IL-4 and ABS-hi using Extracellular Flux Assay kits (XFE96 Flupax mini 102601-100 kit, Seahorse XF DMEM assay medium pack 103680-100 kit, XF cell mitostress test 103015-100 kit; all from Agilent Technologies) and Seahorse XF Pro Analyzer according to manufacturer’s recommendations and previously published protocol ...
-
bioRxiv - Microbiology 2020Quote: ... the primer pair dsbS(H235A)-F/R and a QuikChange II site-directed mutagenesis kit (Stratagene, catalog#:200518) were used ...
-
bioRxiv - Cancer Biology 2022Quote: ... XF Base Media without phenol red (Seahorse Bioscience Inc., Santa Clara, CA) supplemented with 10 mM L-glucose ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA integrity (RIN R 8.0) was confirmed using the High Sensitivity RNA Analysis Kit (DNF-472-0500, Agilent formerly AATI) on a 12-Capillary Fragment Analyzer ...
-
bioRxiv - Neuroscience 2023Quote: QuikChange II Site-Directed Mutagenesis Kit and Dako Fluorescence Mounting Medium were from Agilent Technologies (Santa Clara ...
-
bioRxiv - Cancer Biology 2020Quote: ... using R-Phycoerythrin-conjugated anti-IgM (DAKO). Following incubation ...
-
bioRxiv - Microbiology 2022Quote: ... Serum Free (Agilent Dako) for 90 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Serum Free (Agilent Dako) for 90 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... serum-Free (DAKO, X0909) for 45 minutes ...
-
bioRxiv - Immunology 2023Quote: ... serum free (Dako, USA) at room temperature for 1h in a humidified chamber ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 10 mM glucose (for the Cell Mito Stress Test Kit) or 1 mM glutamine (for the Glycolysis Stress Test Kit) was used as the assay medium (103681-100; Agilent Technologies). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were seeded onto Mat-tek dishes at 200,000 cells/well in serum-free (low glucose) DMEM medium (Agilent Seahorse XF DMEM; 103575-100) supplemented with 4mM L-glutamine ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the Seahorse XF Glycolysis Stress Test (without sodium pyruvate or glucose, Agilent 103020-100) were then performed ...
-
bioRxiv - Physiology 2022Quote: ... the culture medium was changed into 625uL assay medium (Agilent Seahorse XF Base Medium), and then ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10% goat serum (Agilent, #X090710), 0.4% Triton X-100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... serum-free (Dako, Glostrup, Denmark) for 1 hour and then incubated overnight at 4C°with anti-rabbit CD31 antibody (1:100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μL of SST1-F/R PCR product was cloned into pSC-A-amp/kan vector using Strataclone™ PCR Cloning Kit (Agilent, Cat.#240205) following manufacturer’s instructions and transformed into E ...
-
Acinar-to-ductal metaplasia in the pancreas requires a glycolytic switch and functional mitochondriabioRxiv - Cancer Biology 2022Quote: ... the medium was changed to XF assay medium (Agilent) containing 5 g/l glucose ...
-
bioRxiv - Cancer Biology 2023Quote: ... The growth medium was exchanged to substrate-limited medium (Seahorse XF DMEM medium (Agilent, cat# 103575-100), 1 mM Seahorse XF pyruvate solution (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... medium was exchanged for XF Base Medium (Agilent 102353-100) containing glucose (10 mM) ...
-
bioRxiv - Genomics 2021Quote: ... single-stranded DNA libraries were prepared without UDG treatment using the Bravo NGS workstation B (Agilent Technologies), followed by library quantification ...
-
bioRxiv - Molecular Biology 2022Quote: ... Open dishes without a lid were placed on an ice-cold aluminium plate in Stratalinker 2400 (Stratagene) and 254 nm UV light was applied for 30 seconds to cross-link the protein-RNA interactions ...
-
bioRxiv - Bioengineering 2022Quote: Liquid chromatography-mass spectrometry was used to measure glycine concentration without derivatization (Agilent Single-Quadrupole LC/MS). 10 µL of the cell culture was centrifuged at 20,000 g for 2 min ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated serum free media over night and incubated serum-free Seahorse Media (Seahorse Bioscience) supplemented with 0.5 mM glucose ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein Block Serum Free reagent (Dako). Primary antibody incubation was performed at 4°C overnight using the ideal dilution for each antibody (Supplementary Table 5) ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-HER2 (DAKO, polyclonal serum A0485), anti-CDH1 (DAKO ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5% mouse serum (Agilent, Germany). Positive cells were isolated with the micromanipulator and subjected to whole genome amplification.
-
bioRxiv - Cell Biology 2019Quote: ... serum-free Seahorse Media (Seahorse Bioscience) supplemented with 10 mM glucose ...
-
bioRxiv - Cell Biology 2020Quote: ... blocked in 5% donkey serum (Dako) in PBS and incubated with primary antibody (α-TFAM (Mouse ...
-
bioRxiv - Genetics 2023Quote: ... or goat serum (DAKO, cat.no.X090210-8), followed by incubation with primary antibody (overnight ...