Labshake search
Citations for Agilent :
1 - 50 of 6344 citations for Levonorgestrel LNG ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The plate was then measured using a BioTek ELX808 ELISA reader (Agilent) at 450nm and 620-650nm ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were washed between all experimental step with PBS plus 0.1% Tween 20 (405 TS ELISA Plate Washer, Agilent Technologies). Blocking (1% Omniblok ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Molecular Biology 2022Quote: ... Data were collected on a Cytation 5 plate reader (Agilent Technologies) using a green fluorescent polarization filter (excitation and emission wavelengths of 485 nm and 528 nm ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Immunology 2023Quote: Antibodies against SARS-CoV-2 were measured using a high-throughput direct chemiluminescent ELISA performed on MicroLab STAR robotic liquid handlers (Hamilton) fitted with a 405TS/LS LHC2 plate washer (Biotek/Agilent) (full methods described previously)27 ...
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Biophysics 2022Quote: ... or aged samples (T ~ 24 hours) were imaged directly in sealed 384-well microwell plates with a BioTek Cytation Gen 5 imaging plate reader (Agilent) using a 20 x objective ...
-
bioRxiv - Cancer Biology 2022Quote: 5 × 104 cells were plated on XF24 cell culture plate (Agilent, no. 100777-004) with DMEM supplemented with 1 % FBS ...
-
bioRxiv - Microbiology 2023Quote: ... The fixed plates were scanned using the high-content imaging system Cytation 5 (Agilent), with either the GFP channel for rVSV-S or the Texas red channel for rSARS-CoV-2 virus ...
-
bioRxiv - Cancer Biology 2023Quote: ... plates were transferred to the Cytation 5 Cell Imaging Multi-Mode Reader (Biotek/Agilent) driven by Gen5 software (Biotek/Agilent) ...
-
bioRxiv - Cell Biology 2024Quote: 96-well plates containing single-cell clones were imaged on a Cytation 5 microscope (Agilent) 10 days after sorting ...
-
bioRxiv - Cell Biology 2024Quote: ... QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523-5) was used for mutagensis of GFP-VPS35L constructs following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates were consecutively incubated with: rabbit anti-total tau antibody (K9JA, Dako #A0024, 5 μg/ml), anti-rabbit secondary antibody conjugated with biotin (Invitrogen #A16114 ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was then placed in a BioTek Cytation 5 Cell Imaging Multi-Mode Reader (Agilent) and incubated at 37 °C for 3 hours ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... Compound incubated plates and basal plates were then washed with assay media (Seahorse XF DMEM assay media kit (Agilent; #103575-100), 10 mM glucose ...
-
bioRxiv - Systems Biology 2023Quote: ... The cells were plated at 15,000 cells/well onto fibronectin-coated (5 μg/cm2) xCELLigence E-plate (Agilent) wells in serum free medium ...
-
bioRxiv - Bioengineering 2023Quote: All kinetic data were obtained using either a BioTek Synergy H1 or Cytation 5 plate reader (Agilent Technologies). HEX was measured with an excitation peak of 533 nm and an emission peak of 559 nm with a gain of 80 to 100 to ensure fluorescence values were within the linear range of detection ...
-
bioRxiv - Neuroscience 2023Quote: ... The plate was thoroughly washed 5 times with PBS-T and 100 μL of TMB-Blue substrate (DAKO) was added followed by incubation in the dark for 5-10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... the plate containing the follicles was transferred to a live-cell imaging system (Agilent BioTek Cytation 5, USA) to capture images at 6-minute intervals during ovulation ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2021Quote: ... Site-Directed Mutagenesis using the QuikChange II XL kit (Agilent, #200522-5) was performed and the mutations were confirmed by sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... After centrifugation plate was incubated for 5 minutes before being loaded into a Seahorse XF96 Extracellular Flux Analyzer (Agilent). Basal respiration was measured over six hours with 36 ten-minute protocol cycles including a ...
-
bioRxiv - Biochemistry 2023Quote: ... Colonies were stained with Wright-Giesma and plates were scanned using the Biotek Cytation 5 Imaging Multimodal Reader (Agilent). From scanned images ...
-
bioRxiv - Physiology 2024Quote: ... live cells stained with Hoechst 33342 (1:2,000 dilution) (ThermoScientific, Cat#62249) were enumerated using Cytation 5 plate reader (BioTek Instruments - Agilent). Values obtained from the Mito-Stress test were normalized per 1,000 cells.
-
bioRxiv - Bioengineering 2023Quote: ... The luminescence signal which represents the amount of ATP in viable cells was measured with a microtiter well plate reader (BioTek Cytation 5, Agilent).
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were spun down 500 g for 5 min followed by sealing with optical clear permanent seal (Agilent, 24212-001) using the Plateloc Thermal Microplate Sealer (Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: 250 M10M6-PtenC124S cells and 750 M10M6-PtenWT cells were seeded in 384 well plate with 40 µL RPMI-1640 medium containing 5% FBS using Bravo automated liquid handling platform (Agilent). After 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μl were aliquoted into black 96 well plates in triplicate and fluorescence was measured using a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The excitation wavelength used was 488 nm and emission wavelength used was 530 nm.
-
Critical contribution of mitochondria in the development of cardiomyopathy linked to desmin mutationbioRxiv - Pathology 2023Quote: ... seeded (25,000-50,000 cells/well) on Matrigel coated test plates (Extracellular Flux Assay Kit, Agilent) and cultured 4 days in maturation medium prior to measurement ...
-
bioRxiv - Genomics 2021Quote: ... Plates were sealed with a plate-loc (Agilent) and centrifuged for an additional 20 min allowing cells to settle on the pre-dispensed gel ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then washed and 5 × 105 osteoclasts were seeded onto a XF96 plate containing Seahorse XF RPMI medium (Agilent Technologies). The cells were left for 1 h at 37 °C after which the different metabolic drugs were injected (oligomycin 1μM ...
-
bioRxiv - Bioengineering 2024Quote: ... Fluorescence was quantified using an excitation of 530/15 nm and emission of 590/15 nm on a fluorescent plate reader (BioTek Cytation 5, Agilent Technologies).
-
bioRxiv - Bioengineering 2024Quote: ... DMMB solution was added (200 µL/well) and absorbance was measured at 540 nm and 590 nm using a plate reader (BioTek Cytation 5, Agilent Technologies). For all samples ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were sealed using a PlateLoc plate sealer (Agilent) with optical clear seal ...
-
bioRxiv - Bioengineering 2022Quote: ... and the plates were incubated at 37 °C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 45 hours.
-
bioRxiv - Microbiology 2023Quote: ... ODs were obtained by measuring absorbance at 600nM in a 96-well plate using Cytation Station 5 (BioTek Agilent Technologies, Santa Clara, CA). 108 colony-forming units (CFUs ...
-
bioRxiv - Microbiology 2023Quote: ... ODs were obtained by measuring absorbance at 600nM in a 96-well plate using Cytation Station 5 (BioTek Agilent Technologies, Santa Clara, CA). The liquid cultures were centrifuged at 3500 rpm for 5 minutes (Sorvall Legend X1R M20 rotor ...
-
bioRxiv - Bioengineering 2024Quote: ... and the plates were incubated at 37°C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 45 hours.
-
bioRxiv - Bioengineering 2024Quote: ... and the plate was incubated at 37 °C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 48 hours (Fig ...
-
bioRxiv - Bioengineering 2023Quote: ... we first seeded 2,000 cells in specialized Seahorse assay plates (Seahorse XF Cell Mito Stress Test Kit, Agilent) and incubated them for 24h at 33 °C for proliferation and for 7 days at 37 °C for maturation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... Signal was developed with the Envision+ System/HRP Kit in 5–20 min (K4007, Agilent/Dako).
-
bioRxiv - Cancer Biology 2023Quote: ... Signal was developed with the Envision+ System/HRP Kit in 5–20 min (K4007, Agilent/Dako).
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of FAM104A isoform 5 was mutated using the QuikChange XL II kit (Agilent) with primers FAM104A_NL-RR_fwd (5’-cct cta ctt cca cat ccg cca gac ccg cag gga ggc cca ctt cc) ...
-
bioRxiv - Neuroscience 2024Quote: ... mut-shM4 (Table 5) and the QuikChange Multi Site-Directed Mutagenesis kit (200514; Agilent; Manufacturer Instructions) in several assays until all the mutations were incorporated ...
-
bioRxiv - Epidemiology 2019Quote: ... OGTT plasma insulin concentrations were measured by ELISA (Dako UK Ltd., Ely, Cambs, U.K.). Intra-assay imprecision (CV ...