Labshake search
Citations for Agilent :
1 - 50 of 1302 citations for L Phenylalanine N T Boc 2 13C 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... as internal standard were analyzed by 1D 1H and 1H{13C}-HSQC NMR on a 14.1 T DD2 NMR spectrometer (Agilent Technologies, CA). 1D 1H spectra were acquired using the standard PRESAT pulse sequence with 512 transients ...
-
bioRxiv - Microbiology 2021Quote: ... Incorporation of 13C was quantitated and corrected for natural 13C abundance using Profinder B.08.00 (Agilent Technologies). LC-MS data was deposited in the MetaboLights database47 under the accession code MTBLS2374 (www.ebi.ac.uk/metabolights/MTBLS2374).
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 mM L-glutamine (Agilent) and the cells were placed in a non-CO2 incubator set at 37°C for approximately 1 h before starting the assay ...
-
bioRxiv - Immunology 2022Quote: ... and 2 mM L-glutamine (103579-100; Agilent) for 1 h at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM L-glutamine (103579-100, Agilent Technologies) and 1 mM sodium pyruvate (103578-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM L-glutamine (103579-100, Agilent Technologies) and 1 mM sodium pyruvate (103578-100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM l-glutamine (Agilent Technologies, Cat. 103579-100) and 1mM pyruvate (Agilent Technologies ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Microbiology 2023Quote: ... histidine and phenylalanine in the medium were determined with an HPLC system (Agilent 1100, Agilent Technologies, USA) [17] ...
-
bioRxiv - Microbiology 2023Quote: ... histidine and phenylalanine in the medium were determined with an HPLC system (Agilent 1100, Agilent Technologies, USA) [17] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... NMR spectroscopic data (1H, 13C, HSQC, COSY, and HMBC) were collected by Agilent 600 MHz (14.1 Tesla ...
-
bioRxiv - Immunology 2022Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere [11 ...
-
bioRxiv - Immunology 2023Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere (Bigge ...
-
bioRxiv - Biochemistry 2021Quote: ... All 13C NMR spectra were obtained with a Varian VNMRS 600 MHz NMR (Agilent) spectrometer equipped with a 3 mm standard probe ...
-
bioRxiv - Systems Biology 2023Quote: ... 50μL of 200mM ammonium formate pH10 were added to samples and “Fractionation V2.0” was ran on AssayMap BRAVO (Agilent T). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 2 mM L-glutamine for the Glycolysis Stress Test (Agilent #103020-100). After an hour incubation at 37°C ...
-
bioRxiv - Physiology 2022Quote: ... [U-13C]-palmitate enrichment and [1,1,2,3,3-2H]-glycerol enrichment were measured by GC-MS/MS (Agilent GC model 7890A and Waters Quattro Micro) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed 2 times with 200 μL of extracellular flux assay medium (DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine for mitochondrial stress test (Agilent Technologies). Assay medium was then added to each well to make the final well volume 180 uL ...
-
bioRxiv - Cell Biology 2021Quote: ... T-cell lymphoma diagnoses were confirmed by immunohistochemical staining of sections with anti-CD3 antibody (Agilent, M725429-2) and DAB solution development.
-
bioRxiv - Biophysics 2021Quote: ... All mice were anaesthetized (1.5-1.8% isoflurane in 1.5 l/min air with balance in oxygen) and scanned on a 9.4 T Agilent system (Agilent Technologies, Santa Clara, CA, USA) using a 33-mm-diameter transmit/receive coil (Rapid Biomedical GmbH ...
-
bioRxiv - Biophysics 2021Quote: ... All mice were anaesthetized (1.5-1.8% isoflurane in 1.5 l/min oxygen with balance in air) and scanned on a 9.4 T Agilent system (Agilent Technologies, Santa Clara, CA, USA) using a 33-mm-diameter transmit/receive coil (Rapid Biomedical GmbH ...
-
bioRxiv - Biochemistry 2021Quote: ... The CD22 point mutations from tyrosine to phenylalanine were introduced by site-directed mutagenesis according to the QuikChange method (Agilent, Santa Clara, USA).
-
bioRxiv - Immunology 2022Quote: ... a variant mutated to change the tyrosines at positions 179 and 181 to phenylalanines was generated using a QuikChange II Site-Directed Mutagenesis Kit (#200523; Agilent, Santa Clara, CA) and the primer 5’ CATCCCCGCCTTCGCCTTCTATGTCTCACGTTGG 3′ ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by horseradish peroxidase (HRP)-conjugated anti-mouse antibodies (Cat. N. P044701-2, Agilent Technologies LTD, Cheadle, UK) (2.4μg/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS and 10% Methanol for 10 min and incubated overnight with the primary antibody (Table 2) in PBS/T 0.1 with 10 % normal swine/ goat or rabbit serum (Dako). Second ...
-
bioRxiv - Neuroscience 2023Quote: ... These pUAST-(G4C2)n vectors were amplified with a recombinase-mutated SURE®2 Escherichia coli strain (Agilent Technologies) at 28 °C for 72 hours to prevent repeat length contraction ...
-
bioRxiv - Microbiology 2023Quote: ... The produced 13C-CO2 was measured directly from the exetainer headspace with a GC-MS (Agilent 5975C inert MSD). Liquid 13CO2 concentrations were calculated with the Henry coefficient (Supplementary Infomration) ...
-
bioRxiv - Microbiology 2020Quote: Two different glycosidases were used for specific removal of N-glycans: peptide N-glycosidase F (PNGase F) and endo N-glycosidase H (Endo H) (Prozyme, Hayward, CA). PNGase F removes all N-glycans from gp120/41 glycoprotein whereas Endo H removes high-mannose and hybrid glycans ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Pathology 2020Quote: ... Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 450 ng of digested RNA was spiked with 50 ng of internal standard (13C stable isotope-labeled nucleosides from S. cerevisiae) and analyzed by LC-MS (Agilent 1260 Infinity system in combination with an Agilent 6470 Triple Quadrupole mass spectrometer equipped with an electrospray ion source (ESI)) ...
-
bioRxiv - Microbiology 2022Quote: ... the increase of produced 13C-CO2 was measured directly from the headspace with a GC-MS (Agilent 5975C inert MSD). In addition ...
-
bioRxiv - Pathology 2020Quote: ... Abcam, Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Physiology 2022Quote: ... were placed in 50 µl XF medium (non-buffered DMEM containing 10 mM glucose and 2 mM GlutaMax, pH 7.3-7.4, Agilent), centrifuged in a carrier tray (300g for 3 min with no break) ...
-
bioRxiv - Immunology 2020Quote: ... succinate and malate and their corresponding 13C labeled counterparts were extracted and deconvoluted using MassHunter software (Agilent Technologies, New Castle, DE). Retention time consistency was manually rechecked and compared to authentic compounds that were injected under similar chromatographic conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cancer Biology 2020Quote: ... CD8 (T cells, C8/144B, Agilent Technologies), FOXP3 (regulatory T cells ...
-
bioRxiv - Immunology 2022Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Basal OCR and ECAR were measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Immunology 2020Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Immunology 2024Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Bioengineering 2022Quote: ... retinal cross-sections were treated with antigen retrieval solution at 99 °C for 1 h (PH 6.1; Dako #S1699) and washed in 1x PBS ...
-
bioRxiv - Molecular Biology 2020Quote: 100 μL of purified recombinant protein (at approximately 2 mg/mL) were loaded onto a sizeexclusion chromatography column (PL1580-3301, Agilent) in the phosphate buffer (20 mM Tris ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 200 µl min-1 and the digested peptides were captured on a 2 mm x 1 cm C8 trap column (Agilent) and desalted ...
-
bioRxiv - Biophysics 2022Quote: ... a N-STORM 647 nm laser (Agilent), an iXon 897 Ultra EMCCD (Andor Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.4 (Agilent, cat. n. 103575-100). The assay medium only was used as a blank in one well coated with dH2O and one well with Cell-Tak.
-
bioRxiv - Bioengineering 2023Quote: ... 4.6 × 300mm (Agilent, P/N: PL1580-5301) SEC column connected to Agilent 1260 Bioinert Infinity Quaternary Pump System (Pump serial# DEAGH00678) ...
-
bioRxiv - Immunology 2022Quote: ... CD45RA+ naive cells were separated from the CD45RO+ memory T cells by positive selection of memory T cells using CD45RO-Phycoerythrin antibody (DAKO) and magnetically-labeled anti-PE beads (Miltenyi Biotec) ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...