Labshake search
Citations for Agilent :
1 - 50 of 371 citations for L Phenylalanine N T Boc 13C9 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... for 20 min at 97°C (PT-Link, DAKO). Endogenous peroxidase activity was quenched by incubation in peroxidase blocking buffer (DAKO ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Microbiology 2023Quote: ... histidine and phenylalanine in the medium were determined with an HPLC system (Agilent 1100, Agilent Technologies, USA) [17] ...
-
bioRxiv - Microbiology 2023Quote: ... histidine and phenylalanine in the medium were determined with an HPLC system (Agilent 1100, Agilent Technologies, USA) [17] ...
-
bioRxiv - Neuroscience 2021Quote: ... for 20 min at 97°C using a PT Link (Dako – Agilent). Endogenous peroxidase was quenched with Peroxidase-Blocking Solution (S2023 ...
-
bioRxiv - Neuroscience 2021Quote: ... for 20 min at 97°C using a PT Link (Dako – Agilent). Endogenous peroxidase was quenched with Peroxidase-Blocking Solution (S2023 ...
-
bioRxiv - Systems Biology 2023Quote: ... 50μL of 200mM ammonium formate pH10 were added to samples and “Fractionation V2.0” was ran on AssayMap BRAVO (Agilent T). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... at 97°C (24 minutes) or TRS Low pH (Agilent/Dako, Cat. no GV805) at 97°C (20 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... at 97°C (24 minutes) or TRS Low pH (Agilent/Dako, Cat. no GV805) at 97°C (20 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... All mice were anaesthetized (1.5-1.8% isoflurane in 1.5 l/min air with balance in oxygen) and scanned on a 9.4 T Agilent system (Agilent Technologies, Santa Clara, CA, USA) using a 33-mm-diameter transmit/receive coil (Rapid Biomedical GmbH ...
-
bioRxiv - Biophysics 2021Quote: ... All mice were anaesthetized (1.5-1.8% isoflurane in 1.5 l/min oxygen with balance in air) and scanned on a 9.4 T Agilent system (Agilent Technologies, Santa Clara, CA, USA) using a 33-mm-diameter transmit/receive coil (Rapid Biomedical GmbH ...
-
bioRxiv - Biochemistry 2021Quote: ... The CD22 point mutations from tyrosine to phenylalanine were introduced by site-directed mutagenesis according to the QuikChange method (Agilent, Santa Clara, USA).
-
bioRxiv - Immunology 2022Quote: ... a variant mutated to change the tyrosines at positions 179 and 181 to phenylalanines was generated using a QuikChange II Site-Directed Mutagenesis Kit (#200523; Agilent, Santa Clara, CA) and the primer 5’ CATCCCCGCCTTCGCCTTCTATGTCTCACGTTGG 3′ ...
-
bioRxiv - Microbiology 2020Quote: Two different glycosidases were used for specific removal of N-glycans: peptide N-glycosidase F (PNGase F) and endo N-glycosidase H (Endo H) (Prozyme, Hayward, CA). PNGase F removes all N-glycans from gp120/41 glycoprotein whereas Endo H removes high-mannose and hybrid glycans ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was then performed at 97 ° for 10 min with Target Retrieval Solution (Agilent, S236784-2) on a PT Module (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2020Quote: ... Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Pathology 2020Quote: ... Abcam, Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen retrieval was then performed at 97 °C for 10 minutes with Target Retrieval Solution (Agilent, S236784-2) on a PT Module (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... CD8 (T cells, C8/144B, Agilent Technologies), FOXP3 (regulatory T cells ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μm paraffin-embedded tissue sections were either dewaxed and subjected to antigen retrieval treatment with Tris-EDTA buffer pH 9 for 20 min at 97°C using a PT Link (Dako – Agilent) or dewaxed as part of the antigen retrieval process using the Low pH EnVision ™ FLEX Target Retrieval Solutions (K8005 ...
-
bioRxiv - Cell Biology 2020Quote: ... Prior to immunohistochemistry antigen retrieval was performed using Tris-EDTA buffer pH 9 for 20 min at 97°C using a PT Link (Dako – Agilent). Quenching of endogenous peroxidase was performed by a 10 min incubation with Peroxidase-Blocking Solution (Dako REAL S2023) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Antigen unmasking was carried out in a DAKO PT-Link for 20 minutes at 97°C using EnVision FLEX buffer of appropriate pH for each antibody (Agilent). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... Sections were then heated to 97°C for 20 minutes in a high pH target retrieval solution (TRS) (K8004, Agilent) for heat-induced antigen retrieval (HIER) ...
-
bioRxiv - Physiology 2022Quote: ... sections were dewaxed and epitope retrieval was performed using Citrate buffer pH6 for α-SMA and Ter119 or Tris- EDTA buffer pH9 for HMOX1 in all cases for 20 min at 97°C using a PT Link (Dako, Agilent) or with ER2 buffer (AR9640 ...
-
bioRxiv - Bioengineering 2022Quote: ... retinal cross-sections were treated with antigen retrieval solution at 99 °C for 1 h (PH 6.1; Dako #S1699) and washed in 1x PBS ...
-
bioRxiv - Biophysics 2022Quote: ... a N-STORM 647 nm laser (Agilent), an iXon 897 Ultra EMCCD (Andor Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.4 (Agilent, cat. n. 103575-100). The assay medium only was used as a blank in one well coated with dH2O and one well with Cell-Tak.
-
bioRxiv - Bioengineering 2023Quote: ... 4.6 × 300mm (Agilent, P/N: PL1580-5301) SEC column connected to Agilent 1260 Bioinert Infinity Quaternary Pump System (Pump serial# DEAGH00678) ...
-
bioRxiv - Immunology 2022Quote: ... CD45RA+ naive cells were separated from the CD45RO+ memory T cells by positive selection of memory T cells using CD45RO-Phycoerythrin antibody (DAKO) and magnetically-labeled anti-PE beads (Miltenyi Biotec) ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μm paraffin-embedded tissue sections were either dewaxed and subjected to antigen retrieval treatment with Tris-EDTA buffer pH 9 for 20 min at 97°C using a PT Link (Dako – Agilent) or dewaxed as part of the antigen retrieval process using the Low pH EnVision ™ FLEX Target Retrieval Solutions (K8005 ...
-
bioRxiv - Cell Biology 2020Quote: ... Prior to immunohistochemistry antigen retrieval was performed using Tris-EDTA buffer pH 9 for 20 min at 97°C using a PT Link (Dako – Agilent). Quenching of endogenous peroxidase was performed by a 10 min incubation with Peroxidase-Blocking Solution (Dako REAL S2023) ...
-
bioRxiv - Physiology 2022Quote: ... sections were dewaxed and epitope retrieval was performed using Citrate buffer pH6 for α-SMA and Ter119 or Tris- EDTA buffer pH9 for HMOX1 in all cases for 20 min at 97°C using a PT Link (Dako, Agilent) or with ER2 buffer (AR9640 ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Bioengineering 2019Quote: N-linked glycans were released from purified antibody samples by overnight incubation with N-Glyccosidase F (Prozyme, GKE-5006B). The proteins were removed using LudgerClean glycan EB-10 cartridges (Ludger ...
-
bioRxiv - Immunology 2020Quote: ... Generated data were normalized to viable cell number in million/ml at the viability was found to be consistently between 96% and 99% as determined by trypan blue exclusion assay (ViCell, Beckmann Coulter) and analyzed using Seahorse Glycolysis Stress Test Generator (Agilent).
-
bioRxiv - Bioengineering 2022Quote: Retinal cross-sections after deparaffinization were treated with target retrieval solution at 99 °C for 1 h (pH 6.1; Dako #S1699) and washed with 1x PBS ...
-
bioRxiv - Immunology 2021Quote: ... Residual PE-Cy7+ cells were excluded and EYFP+PE+ (CD4+GzB+ T cells) or PE+CD4+ (Ifng-/-CD4+ T cells) were sorted using MoFlo cell sorter (Beckman Coulter/Dako-Cytomation). CD4+GzB+ T cells (2.8 x 105 cells/animal ...
-
bioRxiv - Neuroscience 2020Quote: ... Cat N° R37605) for 20 min and coverslips were mounted with Fluorescence Mounting Medium (Dako, Glostrup, Denmark, Cat N° S3023), while wells in the device were sealed with one drop of mounting medium per well before acquiring images ...
-
bioRxiv - Pathology 2020Quote: ... Deparaffinization and antigen retrieval were performed in Target Retrieval Solution with pH 9 (ACE2) or pH 6 (Ki-67) at 97°C for 20 min using the PT Link platform (Dako, Glostrup, Denmark). Subsequently ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Blots were washed clear of unbound antibody in TBS-T before addition of anti-rabbit-HRP secondary antibody (1:1000 in 5% milk/TBS-T; Agilent Technologies, CA, U.S.A.) for 1 hr at RT ...
-
bioRxiv - Microbiology 2022Quote: ... an ESI-L Mix (Agilent) was injected.
-
bioRxiv - Biochemistry 2022Quote: Offline N-glycan analysis was done using AdvanceBio Gly-X N-glycan prep with InstantPC (GX96-IPC, Agilent Technologies, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: Offline N-glycan analysis was done using AdvanceBio Gly-X N-glycan prep with InstantPC (GX96-IPC, Agilent Technologies, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... 800 µL sample and MTBSTFA (100 µL, N-tert-butyldimethylsilyl)-N-methyltrifluoroacetamide) were transferred to amber capped glass vials (Agilent Technologies, USA), heated to 80 °C for 20 min ...
-
bioRxiv - Systems Biology 2019Quote: ... N-glycans were released by PNGase F (Prozyme, USA) from post nuclear fraction of CHO cell lysate which had been subjected to reduction ...
-
bioRxiv - Microbiology 2022Quote: ... consisting of a model 6890 N gas chromatograph (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... anti-IgL (Clone: N/A; 1:400; Agilent; #GA507), and anti-IgK (Clone ...