Labshake search
Citations for Agilent :
1 - 50 of 5958 citations for Human Urocortin 3 UCN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... SureSelectXT Human All Exon Kits (Agilent) or Human Core Exome (Twist Bioscience ...
-
bioRxiv - Genomics 2019Quote: ... Library construction (Agilent SureSelect Human All Exon kit), quality assessment ...
-
bioRxiv - Genomics 2019Quote: ... SureSelectXT Human all exon V6 kit (Agilent Technologies) was used to capture exons ...
-
bioRxiv - Cancer Biology 2021Quote: ... A SureSelectXT Human All Exon V6 kit (Agilent) was used for exome capture ...
-
bioRxiv - Cancer Biology 2020Quote: ... Library preparation (Agilent SureSelect Human All Exon V6 kit) and high throughout sequencing (Illumina NovaSeq 6000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The Agilent SureSelect Human All Exon v6 kit (Agilent Technologies) was used for whole exome sequencing ...
-
bioRxiv - Genetics 2024Quote: ... The exomes of the subjects were captured by Agilent SureSelect Human All Exon V6 Enrichment kits (Agilent, CA, USA) and then sequenced on a HiSeq X-TEN system (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cancer Biology 2019Quote: Whole Human Genome Microarray Kit 4×44K (Agilent, Cat. No. G4112F) was used to detect mRNA expression levels in cells transfected with control and miR-101-3p transfected HCT116 cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... Exomes were sequenced using the AllExon Human SureSelect v7 Kit (Agilent).
-
bioRxiv - Genomics 2021Quote: ... The Agilent SureSelect Human All ExonV5 Kit (5190-6209, Agilent Technologies) was used for exome capture according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... using a SureSelect Human All Exome V6 capture kit (Agilent, USA) or SeqCap EZ MedExome Enrichment Kit (Roche ...
-
bioRxiv - Genetics 2023Quote: ... The Agilent SureSelect Human All Exon V6 Kit (Agilent Technologies, USA) was applied for exon capture ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Exome capture was performed with the SureSelect Human All Exon v6 kit (Agilent) and sequenced on the Illumina HiSeq platform ...
-
bioRxiv - Immunology 2021Quote: ... Exome sequencing were generated using SureSelect Human All Exon 50Mb Kit (Agilent Technologies) coupled with Illumina HiSeq sequencing system (Illumina) ...
-
bioRxiv - Genomics 2022Quote: ... Sequencing libraries were generated using Agilent SureSelect Human All Exon kit (Agilent Technologies) following the manufacturer’s recommendations and index codes were added to attribute sequences to each sample (experimental details provided in the Supplementary Data).
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Genomics 2019Quote: The FLNC reads from the Isoseq3 refine step were error corrected using Lordec (-k 31 -s 3) with short read RNAseq data from the Universal Human Reference RNA (Agilent) (https://www.ncbi.nlm.nih.gov/sra/SRX1426160 ...
-
bioRxiv - Cancer Biology 2020Quote: The one-color microarray Human miRNA Microarray Kit (V2) design ID 029297 from Agilent Technologies was used to measure miRNA expression for 425 tumors of the Oslo2 cohort using 100 ng total RNA as input ...
-
bioRxiv - Bioengineering 2022Quote: ... The CGH assays were performed using the SurePrint G3 Human CGH Microarray Kit (Agilent) and the genomic DNA of WTC11 cells as a reference of the diploid cells ...
-
bioRxiv - Biophysics 2023Quote: Human FKBP12.6 cDNA was modified by site directed mutagenesis (QuikChange Lightning kit; Agilent Technologies) to introduce one of eight single cysteine mutants (G1C ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Genomics 2019Quote: ... WES libraries were prepared using the SeqCap EZ Exome Kit v3 (NimbleGen) or the SureSelect Human All Exon V7 Low Input Exome kit (Agilent). Equimolar pooled libraries were sequenced on HiSeq 2000 and 4000 instruments (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... The BAMfile used for IGV visualization was generated from WES data obtained with the SureSelect Human All Exon V6 kit (exome capture kit) from Agilent. Group alignment is by chromosome of mate ...
-
bioRxiv - Cancer Biology 2022Quote: ... the 3 liver cancer specimens also underwent bulk-level WES using Agilent SureSelect Human All Exon v7 K it (Agilent, 5191-4005) and illumina NovaSeq 2 × 150 bp sequencing mode ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis of the human l/r-pyk gene was performed with a QuikChange kit (Stratagene). Proteins were expressed in the FF50 strain of Escherichia coli 8 that has both native E ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-exome libraries were prepared using a SureSelectXT Human All Exon V5 kit (Agilent Technologies). The RNA seq library from tumor RNA was prepared using Illumina TruSeq Stranded mRNA Library Prep Kit as per the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: Libraries were generated using the Agilent SureSelect Human All Exon V6 kit (Agilent Technologies, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... genomic DNA libraries were prepared using the SureSelect Human All Exon V6 kit (Agilent Technologies). Exome libraries were subjected to next generation sequencing using DNBseq platform (MGI ...
-
bioRxiv - Genetics 2023Quote: ... exome enrichment was performed using the SureSelect Human All Exon 50 Mb Kit V5 (Agilent). Sequencing was done on a HiSeq4000 (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... WES libraries were prepared using the SureSelect Human All Exon V8 Kit (Agilent; 5191-6873) and sequenced on either a NextSeq 2000 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries for whole-exome sequencing were prepared using the SureSelect Human All Exon V7 kit (Agilent) and the Illumina TruSeq Exome kit ...
-
bioRxiv - Cancer Biology 2021Quote: The sequencing libraries were prepared and captured using SureSelect Human All Exon V4 kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... whole-exome DNA was capture using the SureSelect Human All Exon Kit V5 or V6 (Agilent) and high-throughput sequencing was conducted using the Illumina X10 with a coverage more than 100 X ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were generated using the Agilent SureSelect Human All Exon kit (Agilent Technologies, CA, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Genomics 2020Quote: ... A corresponding screenshot showing read visualization when using the SureSelect Human All Exon V6 kit from Agilent is presented in Figure 5 ...
-
bioRxiv - Genetics 2022Quote: ... WES was performed using the SureSelect XT Human All Exon V6 kits (Agilent, Santa Clara, CA, USA). CLC Genomics Workbench version 7.0.5 (CLCBio ...
-
bioRxiv - Genomics 2021Quote: ... and the exonic regions were captured with Agilent SureSelect Human All Exon v7 Kit (Agilent, 5191-4005). Whole exome sequencing (WES ...
-
bioRxiv - Genomics 2020Quote: ... III14 and IV9 in this family by using SureSelect Human All Exon Kit (Agilent, Santa Clara, CA) to capture the exome and HiSeq2000 platform (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The exome was captured using Agilent SureSelect Human All Exon V5 kit (Agilent, Santa Clara, CA, US) and sequenced in a HiSeq instrument (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pre-capture libraries containing exome sequences were captured using SureSelect Human All Exon V6 kit (Agilent). DNA concentration of the enriched sequencing libraries was measured with the Qubit 3.0 fluorometer dsDNA HS Assay (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: K125R and K125E mutations of human connexin 26 were prepared using the QuikChange II mutagenesis kit (Agilent) and the following primers ...