Labshake search
Citations for Agilent :
1 - 50 of 6572 citations for Estradiol Serum ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and 5% mouse serum (Agilent, Germany). Positive cells were isolated with the micromanipulator and subjected to whole genome amplification.
-
bioRxiv - Cell Biology 2020Quote: ... blocked in 5% donkey serum (Dako) in PBS and incubated with primary antibody (α-TFAM (Mouse ...
-
bioRxiv - Immunology 2023Quote: ... The plate was then measured using a BioTek ELX808 ELISA reader (Agilent) at 450nm and 620-650nm ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were washed between all experimental step with PBS plus 0.1% Tween 20 (405 TS ELISA Plate Washer, Agilent Technologies). Blocking (1% Omniblok ...
-
bioRxiv - Cell Biology 2020Quote: ... permeabilized and blocked in 5% goat serum (DAKO, X0907), 0.3% Triton-X-100 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Physiology 2019Quote: ... PBS-washed sections were blocked with 5% goat serum (Dako, Hamburg, Germany) prior to primary antibody incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Data were collected on a Cytation 5 plate reader (Agilent Technologies) using a green fluorescent polarization filter (excitation and emission wavelengths of 485 nm and 528 nm ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Immunology 2023Quote: Antibodies against SARS-CoV-2 were measured using a high-throughput direct chemiluminescent ELISA performed on MicroLab STAR robotic liquid handlers (Hamilton) fitted with a 405TS/LS LHC2 plate washer (Biotek/Agilent) (full methods described previously)27 ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were then incubated with 5% (v/v) Goat or Donkey Serum (Dako) for 30 min ...
-
bioRxiv - Pathology 2021Quote: ... Blocking was performed in 5% normal goat serum (GS)/PBS (Dako, Glostrup, Denmark) for 60 min ...
-
bioRxiv - Immunology 2022Quote: ... Unspecific binding sites were blocked with Normal Goat Serum (1:5 dilution, DAKO) in antibody diluent (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Biophysics 2022Quote: ... or aged samples (T ~ 24 hours) were imaged directly in sealed 384-well microwell plates with a BioTek Cytation Gen 5 imaging plate reader (Agilent) using a 20 x objective ...
-
bioRxiv - Biochemistry 2020Quote: ... The non-specific binding was blocked for 30 min with 5% rabbit serum (DakoCytomation) for the primary mouse serum(1:600) ...
-
bioRxiv - Cancer Biology 2019Quote: ... sections were incubated for 5 min at room temperature with Protein Block Serum-Free (Dako). The tissue sections were then incubated with the anti-249T-P pAbs or TpMab-1 mAb (1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each cycle included a 5 min blocking step with serum free Protein Block (Agilent, #X0909), primary antibody incubation for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The plate was washed again with medium without serum and analyzed using the Seahorse XFp apparatus (Agilent). The final concentrations of the injected compounds were the following ...
-
bioRxiv - Cancer Biology 2022Quote: 5 × 104 cells were plated on XF24 cell culture plate (Agilent, no. 100777-004) with DMEM supplemented with 1 % FBS ...
-
bioRxiv - Microbiology 2023Quote: ... The fixed plates were scanned using the high-content imaging system Cytation 5 (Agilent), with either the GFP channel for rVSV-S or the Texas red channel for rSARS-CoV-2 virus ...
-
bioRxiv - Cancer Biology 2023Quote: ... plates were transferred to the Cytation 5 Cell Imaging Multi-Mode Reader (Biotek/Agilent) driven by Gen5 software (Biotek/Agilent) ...
-
bioRxiv - Cell Biology 2022Quote: ... residual PBS was removed and cells were blocked with 5% Normal Swine Serum (NSS, Dako, X0901) in PBS for 20 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were blocked with 5 μg/ml human immunoglobulins solved in blocking serum-free medium (Dako) for 30 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: 96-well plates containing single-cell clones were imaged on a Cytation 5 microscope (Agilent) 10 days after sorting ...
-
bioRxiv - Cell Biology 2024Quote: ... QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523-5) was used for mutagensis of GFP-VPS35L constructs following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... The sections were rinsed in PBS/Tween buffer and treated with 5% Normal Goat Serum (Dako X0907) for 30 minutes after which they were incubated overnight at 4°C with a 1:25 dilution of F4/80 monoclonal rat anti-mouse antibody BM8 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were immersed in 5% normal non-immune goat serum (DakoX0907, Agilent Technologies Inc., CA, USA) for 15min and thereafter rinsed in 0.01M phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates were consecutively incubated with: rabbit anti-total tau antibody (K9JA, Dako #A0024, 5 μg/ml), anti-rabbit secondary antibody conjugated with biotin (Invitrogen #A16114 ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was then placed in a BioTek Cytation 5 Cell Imaging Multi-Mode Reader (Agilent) and incubated at 37 °C for 3 hours ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... Slides were washed 3X 5 mins with 1X PBS and blocked in DAKO protein-free serum block (DAKO) overnight in a humidified chamber at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Compound incubated plates and basal plates were then washed with assay media (Seahorse XF DMEM assay media kit (Agilent; #103575-100), 10 mM glucose ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated with 1 × blocking buffer (5% goat serum [#X0907, Dako], 2.5% BSA, 0.1% Triton X-100 in PBS) (38) ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were blocked in 0.2% triton X-100 solution containing 1% BSA and 5% normal goat serum (DAKO, X0907) for 1 hour.
-
bioRxiv - Systems Biology 2023Quote: ... The cells were plated at 15,000 cells/well onto fibronectin-coated (5 μg/cm2) xCELLigence E-plate (Agilent) wells in serum free medium ...
-
bioRxiv - Bioengineering 2023Quote: All kinetic data were obtained using either a BioTek Synergy H1 or Cytation 5 plate reader (Agilent Technologies). HEX was measured with an excitation peak of 533 nm and an emission peak of 559 nm with a gain of 80 to 100 to ensure fluorescence values were within the linear range of detection ...
-
bioRxiv - Neuroscience 2023Quote: ... The plate was thoroughly washed 5 times with PBS-T and 100 μL of TMB-Blue substrate (DAKO) was added followed by incubation in the dark for 5-10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... the plate containing the follicles was transferred to a live-cell imaging system (Agilent BioTek Cytation 5, USA) to capture images at 6-minute intervals during ovulation ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were washed for 5 minutes using 1X Wash Buffer and then blocked by adding 8 drops of Protein Block Serum-Free (Agilent). Primary antibodies were diluted in diluent (Dako ...
-
bioRxiv - Cell Biology 2020Quote: The cells were fixed with 4% paraformaldehyde at 4°C for 5 min and permeabilized with 0.1% Triton X-100 at room temperature for 20 min in the presence of a protein-blocking solution consisting of PBS supplemented with 5% normal goat serum (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5% serum) before analysis of OCR and ECAR in a Metabolic Flux Analyzer (Seahorse Bioscience, North Billerica, MA 96XP).
-
bioRxiv - Cell Biology 2022Quote: ... Non-specific antibody binding was blocked by incubation for 30 min with blocking solution containing 5% normal goat serum (NGS, Dako) at room temperature followed by overnight incubation at 4 °C with different primary antibodies listed in Table 1 ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2021Quote: ... Site-Directed Mutagenesis using the QuikChange II XL kit (Agilent, #200522-5) was performed and the mutations were confirmed by sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... After centrifugation plate was incubated for 5 minutes before being loaded into a Seahorse XF96 Extracellular Flux Analyzer (Agilent). Basal respiration was measured over six hours with 36 ten-minute protocol cycles including a ...
-
bioRxiv - Biochemistry 2023Quote: ... Colonies were stained with Wright-Giesma and plates were scanned using the Biotek Cytation 5 Imaging Multimodal Reader (Agilent). From scanned images ...
-
bioRxiv - Physiology 2024Quote: ... live cells stained with Hoechst 33342 (1:2,000 dilution) (ThermoScientific, Cat#62249) were enumerated using Cytation 5 plate reader (BioTek Instruments - Agilent). Values obtained from the Mito-Stress test were normalized per 1,000 cells.