Labshake search
Citations for Agilent :
1 - 50 of 3692 citations for DIRAS Family GTP Binding RAS Like 1 DIRAS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK; 1:800) in Antibody Diluent (S0809, Agilent DAKO). Following removal of excess primary antibody with wash buffer ...
-
bioRxiv - Immunology 2022Quote: ... Antibody binding was detected with DAB+ chromogen (DAKO, Agilent technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK; 1:800) in Antibody Diluent (S0809, Agilent DAKO). Following removal of excess primary antibody with wash buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-Spike antibody binding was detected using HRP-conjugated anti-rabbit secondary antibodies (1 in 7000 dilution) (Dako) and visualized using ECL (KPL ...
-
bioRxiv - Biochemistry 2024Quote: ... any unbound GTP was washed out and the bound GTP levels were measured on Biotek Synergy HT (Agilent, Winooski, VT).
-
bioRxiv - Cell Biology 2023Quote: ... Successful differentiation into cholangiocyte-like and hepatocyte-like cells was tested validated by immunostaining against albumin (Agilent, Cat. Nr. A0001). Primary human hepatocytes (PHHs ...
-
bioRxiv - Microbiology 2022Quote: ... Antibody binding was detected using horseradish peroxidase– labelled rabbit anti-guinea pig antibody (Dako, Glostrup, Denmark) and 5,5’-dithiobis-(2-nitrobenzoic acid) ...
-
bioRxiv - Neuroscience 2021Quote: ... Non-specific antibody binding was blocked by Serum-free protein block (Dako). Samples were incubated for 12 hr in a solution containing the following primary antibodies ...
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: ... Antibody binding was visualized using the Liquid DAB+ Substrate Chromogen System (Dako). Samples were counterstained for 1 minute with hematoxylin ...
-
bioRxiv - Genomics 2023Quote: ... Non-specific antibody binding was blocked with Protein Block Serum-Free (Dako) for 10 minutes ...
-
bioRxiv - Immunology 2021Quote: ... The nonspecific binding of antibodies was blocked using 10% normal goat serum (DAKO) in PBS for 20 minutes at room temperature ...
-
bioRxiv - Genetics 2020Quote: ... Bindings were revealed by a HRP-conjugated anti-mouse/rabbit IgG antibodies (Dako) and ECL (Advansta ...
-
bioRxiv - Systems Biology 2019Quote: The antibody binding sites on cell lines were determined with the QIFIKIT (Dako, # K0078) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: ... The antigen-antibody bindings were detected with labeled polymer-HRP Envision system (DAKO, K4007) and DAB+ chromogen (DAKO ...
-
bioRxiv - Immunology 2022Quote: ... Antibody binding was visualized using Dako EnVision + Dual Link System-HRP (DAB+) staining (DAKO) according to the manufacturer’s procedure ...
-
bioRxiv - Immunology 2022Quote: ... Antibody binding was detected with DAB+ chromogen (DAKO, Agilent technologies, Santa Clara, Ca, USA) and the sections were counterstained with hematoxylin (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... In addition to blocking unspecific antibody binding using Serum-Free Protein Block (X0909, Agilent) for 10 minutes ...
-
bioRxiv - Bioengineering 2021Quote: ... and Iba-1 (ionized calcium binding adaptor protein, 1:5000, Dako, Cat#019-19741). Mouse anti-SARS-CoV-2 N monoclonal antibody (1:5000 ...
-
bioRxiv - Genomics 2020Quote: ... III14 and IV9 in this family by using SureSelect Human All Exon Kit (Agilent, Santa Clara, CA) to capture the exome and HiSeq2000 platform (Illumina ...
-
bioRxiv - Pathology 2023Quote: ... Specific antibody binding was detected using a second antibody and the LSAB system (Dako Corporation, Carpinteria CA, USA, K690) for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-S100 calcium-binding protein B β-subunit (S100-β) polyclonal antibody (Agilent Dako ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-S100 calcium-binding protein B β-subunit (S100-β) polyclonal antibody (Agilent Dako, Santa Clara, CA, USA Z0311, 1:400). Following washing ...
-
bioRxiv - Cell Biology 2020Quote: ... The non-specific binding of antibodies was blocked using 10% Normal Goat Serum (DAKO, Glostrup, Denmark) in PBS for 20 minutes at RT ...
-
bioRxiv - Immunology 2021Quote: ... Antibody binding was visualized by FLEX 3,3’-diaminobenzidine (DAB) substrate working solution and haematoxylin counterstain (Dako) following the protocols provided by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibody binding was visualized using FLEX 3,3′ -diaminobenzidine (DAB) substrate working solution and hematoxylin counterstain (Dako). For negative controls ...
-
bioRxiv - Immunology 2022Quote: ... Unspecific binding sites were blocked with Normal Goat Serum (1:5 dilution, DAKO) in antibody diluent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... the plates were incubated with serially diluted serum samples for 2 h at room temperature and antibody binding detected using horseradish peroxidase–labelled rabbit anti-guinea pig antibody (Dako, Glostrup, Denmark) and 5,5’-dithiobis-(2-nitrobenzoic acid) ...
-
bioRxiv - Microbiology 2021Quote: ... Binding of the primary antibody was detected using Envision rabbit polymer with AEC as the chromogen (Dako). Each tissue section was evaluated independently by two pathologists ...
-
bioRxiv - Neuroscience 2024Quote: ... Every fourth section from approximately bregma −1.40 mm to −2.00 mm were immunostained with ionized calcium binding adaptor molecule 1 (Iba1; 1:2000; FUJIFILM Wako) and glial fibrillary acidic protein (GFAP; 1:1000; Dako); 4-6 sections per brain ...
-
bioRxiv - Cell Biology 2020Quote: To identify the causative mutation in these families we sequenced the whole exome of the affected individuals with the SureSelect human AllExon 50Mb kit (Agilent Technologies) and sequenced on the HiSeq 2500 (Illumina ...
-
bioRxiv - Biochemistry 2024Quote: ... The unhydrolyzed GTP that was converted to ATP was recorded on BioTek Synergy HT (Agilent, Winooski, VT).
-
bioRxiv - Cell Biology 2022Quote: ... Non-specific antibody binding was blocked by incubation for 30 min with blocking solution containing 5% normal goat serum (NGS, Dako) at room temperature followed by overnight incubation at 4 °C with different primary antibodies listed in Table 1 ...
-
bioRxiv - Cancer Biology 2019Quote: Site-directed mutagenesis to generate the mutant RAS clones was performed with a QuikChange mutagenesis kit (Stratagene) and the primers for amino acid 180 site mutation of KRAS4A are CAGCAAAGAAGAAAAGACTCCTGGCAGTGTGAAAATT and AATTTTCACACTGCCAGGAGTCTTTTCTTCTTTGCTG.
-
bioRxiv - Cell Biology 2020Quote: ... Specific binding was detected with Envision-HRP (Dako) and DAB (Dako ...
-
bioRxiv - Genomics 2023Quote: Each purified GST-tagged DBD stock was validated for DNA-binding specificity using 4×44k universal protein-binding microarrays (PBMs) (Agilent Technologies), as described previously42 ...
-
bioRxiv - Genetics 2024Quote: ... Whole exome sequencing was performed on genomic DNA extracted from the peripheral lymphocytes of the patients and their families using the SureSelect Human All Exon Kit V6 (Agilent Technologies, Santa Clara, CA, USA) with sequencing on the NovaSeq 6000 platform (Illumina ...
-
Cdc42 promotes epithelial morphogenesis by coupling Par-complex and Crumbs recruitment via Par6-aPKCbioRxiv - Cell Biology 2019Quote: ... To disrupt binding of the WASp CRIB domain to Cdc42-GTP, substitutions F240D H242D and H245D were introduced (after (Tskvitaria-Fuller et al., 2006)) using the QuikChange Mutagenesis System (Agilent). Following sequence verification of both constructs ...
-
bioRxiv - Cancer Biology 2022Quote: ... All K-Ras secondary mutant and wild-type K-Ras constructs were generated by a PCR based strategy using a site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The gel-like image of the 2100 Bioanalyzer result was visualized using the 2100 Expert Software (ver. B.02.11, Agilent Technologies) in pseudo colors with default settings ...
-
bioRxiv - Genomics 2020Quote: ... HNRNPM binding sites were mutated using QuikChange XLII Mutagenesis Kit (Stratagene). For flow cytometry assays ...
-
bioRxiv - Cancer Biology 2021Quote: ... binding was detected with the diaminobenzidine-peroxidase visualization system (EnVision+, Dako). Mayer’s hematoxylin was used for counterstaining ...
-
bioRxiv - Bioengineering 2022Quote: ... binding buffers and processed on Agilent 2100 Bioanalyzer (Agilent CA, USA) to determine the yield and size distribution of each library.
-
bioRxiv - Cancer Biology 2023Quote: ... Nonspecific binding sites were blocked using Protein Block Serum free (DAKO) for 10 minutes ...
-
bioRxiv - Immunology 2023Quote: ... brucei parasites using a polyclonal rabbit antibody raised against T. brucei luminal binding protein 1 (BiP) (J. Bangs, SUNY, USA) using a Dako Autostainer Link 48 (Dako, Denmark) and were subsequently counterstained with Gill’s Haematoxylin ...
-
Targeting adipocyte ESRRA promotes osteogenesis and vascular formation in adipocyte-rich bone marrowbioRxiv - Molecular Biology 2023Quote: ... The putative ESRRA binding site 1 was mutated using PCR-based site-directed mutagenesis and QuikChange Site-Directed Mutagenesis Kit (Stratagene #200518) to obtain mutated constructs pGL3-Leptin mut 1-luc.
-
bioRxiv - Plant Biology 2020Quote: ... and 0.1 g samples were then used to measure RA and SAB contents by high-performance liquid chromatography-tandem mass spectrometry as reported previously (Agilent 1200, USA)(Zhou et al. ...
-
bioRxiv - Pathology 2021Quote: ... anti-CD3 antibody (1:200; DAKO; Ref ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies: PCNA (1:250, Dako), L-plastin (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies: GFAP (DAKO, Z0334, 1:500), AQP4 (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... and rabbit anti-LC3B (1:1000) antibodies in Antibody Diluent (Dako) as primary antibodies ...