Labshake search
Citations for Agilent :
1 - 50 of 6358 citations for Cyclic GMP Direct Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Antibodies against SARS-CoV-2 were measured using a high-throughput direct chemiluminescent ELISA performed on MicroLab STAR robotic liquid handlers (Hamilton) fitted with a 405TS/LS LHC2 plate washer (Biotek/Agilent) (full methods described previously)27 ...
-
bioRxiv - Immunology 2023Quote: ... Site-direct mutagenesis (QuikChange Multi kit, Agilent) was used create the plasmids encoding the Prime ...
-
bioRxiv - Immunology 2023Quote: ... The plate was then measured using a BioTek ELX808 ELISA reader (Agilent) at 450nm and 620-650nm ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were washed between all experimental step with PBS plus 0.1% Tween 20 (405 TS ELISA Plate Washer, Agilent Technologies). Blocking (1% Omniblok ...
-
bioRxiv - Biophysics 2024Quote: ... Site-direct mutagenesis was performed using QuickChange II XL kit (Agilent Technologies) to generate the single hERG mutations ...
-
bioRxiv - Molecular Biology 2023Quote: ... A GMP grade chemically modified single guide RNA (sgRNA) targeting the HBB locus was purchased from Agilent with modifications for 2ʹ-O-methyl-3ʹ-phosphorothioate at the three terminal nucleotides of the 5ʹ and 3ʹ ends with the sequence 5ʹ-CTTGCCCCACAGGGCAGTAA-3ʹ ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... Two PstI sites on the vector were mutated with a site-direct mutagenesis kit (Agilent)—PstI-free pcDNA3.1(+ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Data were collected on a Cytation 5 plate reader (Agilent Technologies) using a green fluorescent polarization filter (excitation and emission wavelengths of 485 nm and 528 nm ...
-
bioRxiv - Plant Biology 2022Quote: Cyclic-ADP ribose was analysed using a 1290 Infinity UHPLC system equipped with a 6546 Q-ToF (Agilent). Separation was on a 100×2.1mm 2.6μ Kinetex EVO C18 column connected in series to a 100×2.1mm 2.6μ Kintex F5 column (both Phenomenex ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Cell Biology 2021Quote: ... The QuikChange II XL direct-mutagenesis kit was obtained from Stratagene (cat#200522, La Jolla, CA, USA) and the Vybrant Apoptosis Pacific Blue-annexin V kit and 7AAD from Invitrogen (cat#A35122).
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Biophysics 2022Quote: ... or aged samples (T ~ 24 hours) were imaged directly in sealed 384-well microwell plates with a BioTek Cytation Gen 5 imaging plate reader (Agilent) using a 20 x objective ...
-
bioRxiv - Immunology 2022Quote: ... Point mutations (e.g., CARD8 S297A, E274R) were generated using the QuikChange II site-direct mutagenesis kit (Agilent, 200523) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: 5 × 104 cells were plated on XF24 cell culture plate (Agilent, no. 100777-004) with DMEM supplemented with 1 % FBS ...
-
bioRxiv - Microbiology 2023Quote: ... The fixed plates were scanned using the high-content imaging system Cytation 5 (Agilent), with either the GFP channel for rVSV-S or the Texas red channel for rSARS-CoV-2 virus ...
-
bioRxiv - Cancer Biology 2023Quote: ... plates were transferred to the Cytation 5 Cell Imaging Multi-Mode Reader (Biotek/Agilent) driven by Gen5 software (Biotek/Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The tau P301L mutants were generated by PCR using QuickChange Lightning Site-Direct mutagenesis kit (Agilent Technologies, Santa Clara, USA). For all intermolecular sensors ...
-
bioRxiv - Cell Biology 2024Quote: 96-well plates containing single-cell clones were imaged on a Cytation 5 microscope (Agilent) 10 days after sorting ...
-
bioRxiv - Cell Biology 2022Quote: ... Libraries were bisulfite converted with the EZ-96 DNA Methylation-Direct MagPrep kit and cleaned up using an automated liquid handling platform (Agilent Bravo). The bisulfite converted libraries were amplified for 12 cycles with KAPA HiFi HotStart Uracil+ ReadyMix (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... we carried out site direct mutagenesis of pCR-ompT-GFP according to the Quikchange II site-directed mutagenesis kit (Agilent Technologies).
-
bioRxiv - Cell Biology 2024Quote: ... QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523-5) was used for mutagensis of GFP-VPS35L constructs following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates were consecutively incubated with: rabbit anti-total tau antibody (K9JA, Dako #A0024, 5 μg/ml), anti-rabbit secondary antibody conjugated with biotin (Invitrogen #A16114 ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was then placed in a BioTek Cytation 5 Cell Imaging Multi-Mode Reader (Agilent) and incubated at 37 °C for 3 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... The substitution S59D and S59A were introduced into the pLVX-IRES-FLAG-tagged HERPUD1 vector using the QuikChange II XL direct-mutagenesis kit (Stratagene, cat#200522) and the mutagenesis service of GenScript (Hong Kong ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: ... The PCRs products were direct sequenced or subcloned into pBlueScript (Stratagene) followed by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Compound incubated plates and basal plates were then washed with assay media (Seahorse XF DMEM assay media kit (Agilent; #103575-100), 10 mM glucose ...
-
bioRxiv - Systems Biology 2023Quote: ... The cells were plated at 15,000 cells/well onto fibronectin-coated (5 μg/cm2) xCELLigence E-plate (Agilent) wells in serum free medium ...
-
bioRxiv - Bioengineering 2023Quote: All kinetic data were obtained using either a BioTek Synergy H1 or Cytation 5 plate reader (Agilent Technologies). HEX was measured with an excitation peak of 533 nm and an emission peak of 559 nm with a gain of 80 to 100 to ensure fluorescence values were within the linear range of detection ...
-
bioRxiv - Neuroscience 2023Quote: ... The plate was thoroughly washed 5 times with PBS-T and 100 μL of TMB-Blue substrate (DAKO) was added followed by incubation in the dark for 5-10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... the plate containing the follicles was transferred to a live-cell imaging system (Agilent BioTek Cytation 5, USA) to capture images at 6-minute intervals during ovulation ...
-
bioRxiv - Biophysics 2021Quote: ... All mutants were generated using the Quickchange site-direct mutagenesis method (Agilent). The vector was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... All mutations were introduced into hHv1 by site-direct mutagenesis (Agilent Inc.) and confirmed by DNA sequencing ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2021Quote: ... Site-Directed Mutagenesis using the QuikChange II XL kit (Agilent, #200522-5) was performed and the mutations were confirmed by sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... After centrifugation plate was incubated for 5 minutes before being loaded into a Seahorse XF96 Extracellular Flux Analyzer (Agilent). Basal respiration was measured over six hours with 36 ten-minute protocol cycles including a ...
-
bioRxiv - Biochemistry 2023Quote: ... Colonies were stained with Wright-Giesma and plates were scanned using the Biotek Cytation 5 Imaging Multimodal Reader (Agilent). From scanned images ...
-
bioRxiv - Physiology 2024Quote: ... live cells stained with Hoechst 33342 (1:2,000 dilution) (ThermoScientific, Cat#62249) were enumerated using Cytation 5 plate reader (BioTek Instruments - Agilent). Values obtained from the Mito-Stress test were normalized per 1,000 cells.
-
bioRxiv - Bioengineering 2023Quote: ... The luminescence signal which represents the amount of ATP in viable cells was measured with a microtiter well plate reader (BioTek Cytation 5, Agilent).
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were spun down 500 g for 5 min followed by sealing with optical clear permanent seal (Agilent, 24212-001) using the Plateloc Thermal Microplate Sealer (Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: 250 M10M6-PtenC124S cells and 750 M10M6-PtenWT cells were seeded in 384 well plate with 40 µL RPMI-1640 medium containing 5% FBS using Bravo automated liquid handling platform (Agilent). After 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μl were aliquoted into black 96 well plates in triplicate and fluorescence was measured using a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The excitation wavelength used was 488 nm and emission wavelength used was 530 nm.
-
Critical contribution of mitochondria in the development of cardiomyopathy linked to desmin mutationbioRxiv - Pathology 2023Quote: ... seeded (25,000-50,000 cells/well) on Matrigel coated test plates (Extracellular Flux Assay Kit, Agilent) and cultured 4 days in maturation medium prior to measurement ...
-
bioRxiv - Genomics 2021Quote: ... Plates were sealed with a plate-loc (Agilent) and centrifuged for an additional 20 min allowing cells to settle on the pre-dispensed gel ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then washed and 5 × 105 osteoclasts were seeded onto a XF96 plate containing Seahorse XF RPMI medium (Agilent Technologies). The cells were left for 1 h at 37 °C after which the different metabolic drugs were injected (oligomycin 1μM ...
-
bioRxiv - Bioengineering 2024Quote: ... Fluorescence was quantified using an excitation of 530/15 nm and emission of 590/15 nm on a fluorescent plate reader (BioTek Cytation 5, Agilent Technologies).