Labshake search
Citations for Agilent :
1 - 50 of 1853 citations for Caspase Recruitment Domain Family Member 17 CARD17 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... slices were then incubated with anti-cleaved caspase 3 antibody or anti-Ki67 antibody (Cell Signalling) and further processed with secondary antibody (LSAB2 horseradish peroxidase kit; Dako, Copenhagen, Denmark).
-
bioRxiv - Bioengineering 2020Quote: A computationally designed 200,000-member naïve nanobody CDR3 library was synthesized as an oligonucleotide pool of CDR3 sequences by Agilent, as previously reported (29) ...
-
bioRxiv - Cell Biology 2021Quote: The CC and ORD domains of ORP5 or the TM domain of ORP8 were deleted using site-directed mutagenesis (Quickchange II-XL, Stratagene) to generate EGFP-ORP5ΔCC and EGFP-ORP5ΔORD or EGFP-ORP8ΔTM.
-
bioRxiv - Cancer Biology 2021Quote: ... W503F (PBD, polo-box domain 1) and H629A, K631M (PBD, polo-box domain 2) were generated by site-directed mutagenesis (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... III14 and IV9 in this family by using SureSelect Human All Exon Kit (Agilent, Santa Clara, CA) to capture the exome and HiSeq2000 platform (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: To identify the causative mutation in these families we sequenced the whole exome of the affected individuals with the SureSelect human AllExon 50Mb kit (Agilent Technologies) and sequenced on the HiSeq 2500 (Illumina ...
-
bioRxiv - Biochemistry 2019Quote: ... The ASK1 SAM domain was amplified from the MegaMan Transcriptome library (Agilent). Constructs comprising ASK2 and ASK3 were amplified from Addgene plasmids (#69727 and #69728 ...
-
bioRxiv - Biochemistry 2024Quote: ... K101N mutations in pBAD24 using the GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) with the manufacturer’s protocol and the following primers ...
-
bioRxiv - Immunology 2019Quote: ... Additional mutations within the thioester domain were introduced by QuickChange site-directed mutagenesis (Stratagene). LRIM1 and APL1C were subcloned into the pFastbac-Dual vector with C-terminal 6×His tag on APL1C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Error-prone PCR was performed using the GeneMorph II EZClone Domain Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: The smcR mutant alleles were created using GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) as per the company protocol targeting the smcR gene encoded on plasmid pJN22 ...
-
bioRxiv - Cancer Biology 2023Quote: ... for cleaved Caspase-3 and HRP labeled polymer and DAB chromagen (Dako) for PCNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Staining was performed following the epitope retrieval process using VectaStain Kit from Vector Labs for cleaved Caspase-3 and horseradish peroxidase-labeled polymer from Dako (K4001) for PCNA ...
-
bioRxiv - Genetics 2024Quote: ... Whole exome sequencing was performed on genomic DNA extracted from the peripheral lymphocytes of the patients and their families using the SureSelect Human All Exon Kit V6 (Agilent Technologies, Santa Clara, CA, USA) with sequencing on the NovaSeq 6000 platform (Illumina ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: Libraries of ProQ mutants were generated by using GeneMorph II EZClone Domain Mutagenesis Kit (Agilent). As template ...
-
bioRxiv - Cancer Biology 2022Quote: ... EZH2’s SET domain deletion was generated by a site-directed mutagenesis kit (Agilent, 200521). All plasmids were verified by Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... the PH domain in HA-ORP5wt was deleted by site-directed mutagenesis (Quickchange II-XL, Stratagene) as in (Galmes et al. ...
-
bioRxiv - Immunology 2020Quote: ... The RBD domain of SARS-CoV-2 S was biotinylated and tetramerized with streptavidin-APC (Agilent). The APC decoy reagent was generated by conjugating SA-APC to Dylight 755 using a DyLight 755 antibody labeling kit (ThermoFisher) ...
-
bioRxiv - Plant Biology 2020Quote: ... Mutations were introduced into the CCT domain by site-directed mutagenesis (Pfu Turbo DNA polymerase, Agilent) and all the constructs were verified by sequencing and subsequently transformed into BL21-CodonPlus (DE3)-RIL Competent Cells for protein production.
-
bioRxiv - Cell Biology 2019Quote: Cleaved Caspase-3 staining required 5 minute treatment with Target Retrieval Solution (DAKO S1700), 1 hour room temperature incubation with Cleaved Caspase-3 (Asp175 ...
-
bioRxiv - Microbiology 2024Quote: ... The luminescence of caspase was measured with a Synergy H1 microplate reader (Agilent Technologies) and expressed as relative luminescence units (RLU ...
-
bioRxiv - Genetics 2021Quote: Mutagenesis of the sequence encoding Sir3464-728 using the GeneMorph II EZClone Domain Mutagenesis Kit (Agilent, 200552-5) was performed by PCR on 9,5 µg of pACT2-SIR3464-728 with 20 cycles of amplification to allow low mutation rate ...
-
bioRxiv - Microbiology 2021Quote: ... Mutageneses of the VqmAPhage and VqmAVc DBDs was accomplished using the GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The AR DBD domain DNA fragment was amplified using Herculase II Fusion DNA Polymerase (Agilent Technologies; cat. 600677) with 36 cycles and annealing at 63.5°C ...
-
bioRxiv - Biophysics 2023Quote: ... A non-cleavable T855G mutant of this Lphn3 GAIN domain fusion protein was generated using QuikChange II XL (Agilent) site-directed mutagenesis with primers 5’-ATG CAG CTG TAA TCA CCT GGG CAA CTT TGC TGT CCT GAT G -3’ and 5’-CAT CAG GAC AGC AAA GTT GCC CAG GTG ATT ACA GCT GCA T -3’.
-
bioRxiv - Biochemistry 2023Quote: ... GST and GST-fused CBS-pair domain of murine CNNM2 were expressed in transformed BL21 (DE3) cells (Stratagene, CA). Bacterial cells were lysed by sonication in ice-cold PBS containing 1% Triton X-100 and protease inhibitor phenylmethylsulfonyl fluoride (Sigma–Aldrich) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Fluorescence was monitored for 17 h using a Cytation 5 device (BioTek, Agilent, Winooski, VT, USA). Excitation was provided by a monochromator ...
-
bioRxiv - Immunology 2021Quote: ... The derivative was injected into the GC/MS equipped with a DB-17 column (Agilent Technologies) and measured in SIM mode monitoring ions m/z 435 (M+0) ...
-
bioRxiv - Biophysics 2019Quote: Human CAMSAP1 residues 1474-1613 encompassing the CKK domain (HsCKK) were cloned into pET28a vector and expressed in BL21(DE3) cells (Stratagene). Following purification via immobilized metal-affinity chromatography (IMAC ...
-
bioRxiv - Immunology 2019Quote: ... mutant with Cys20 to Arg and Cys23 to Ser mutations in the RING1 domain was made by site-directed mutagenesis using Quickchange (Stratagene) with primers CCGCTGGTGTCTAGAAAGCTCAGTCTTGGGGAGTAC and GTACTCCCCAAGACTGAGCTTTCTAGACACCAGCGG ...
-
bioRxiv - Cancer Biology 2019Quote: ... The RCC1 domain was deleted using the Quickchange® II XL Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Stratagene) using the primer sequences ...
-
bioRxiv - Cell Biology 2020Quote: ... The cytoplasmic and KASH domains of the mini-nesprin constructs were obtained from a previous publication.22 The mutant domain was made from this construct by site-directed mutagenesis (Quikchange II XL, Agilent). The DN-KASH construct was made by ligation after digestion by ClaI of a PCR product from the mini-nesprin construct ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: ... The purified PCR products were subsequently used as megaprimers to generate the library of mutants in the plasmid pZE-ProQ-3×FLAG by following GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) guidelines ...
-
bioRxiv - Microbiology 2021Quote: A library of IpaC mutants with missense mutations in the coiled-coil domain and flanking regions was generated using error-prone PCR with the GeneMorphII (Agilent) domain mutagenesis kit ...
-
bioRxiv - Biophysics 2020Quote: The deletion construct containing the catalytic domain and the interdomain linker (CreCat, residues 127-343) was prepared using QuikChange Site-Directed Mutagenesis Kit (Agilent) from a pET21A vector (Novagen ...
-
bioRxiv - Biochemistry 2019Quote: Mutants were generated for each domain by introducing single point mutations using the Quick change site-directed mutagenesis kit (Stratagene). The primer sequences used for mutagenesis are listed in the supplementary S1 Table ...
-
bioRxiv - Genetics 2021Quote: ... while the domain deletions were constructs from initial cDNA constructs using the site-directed mutagenesis kit QuikChange™ (Agilent Technologies) and adequate primers (Supplemental Table S4) ...
-
bioRxiv - Cell Biology 2020Quote: ... including glutathione S-transferase (GST)-NEPH1 cytoplasmic domain (CD) and GST-NEPHRIN CD were expressed and purified from Escherichia coli BL21 cells (Stratagene). Purified phosphorylated GST-NEPH1 was expressed and purified from TKB1 cells (Stratagene) ...
-
bioRxiv - Biochemistry 2021Quote: ... The kinase domain c-Abl mutations were introduced into the human c-Abl kinase domain by site-directed mutagenesis using the QuikChange II kit (Agilent) and verified by DNA sequencing.
-
bioRxiv - Cancer Biology 2021Quote: ... first an AgeI cut-site was knocked into the pcDNA3.1-Myoferlin-HA plasmid immediately prior to the transmembrane domain by site-directed mutagenesis (Agilent: 210518). Second ...
-
bioRxiv - Genomics 2020Quote: ... The indicated domain deletions and point mutations were generated by site-directed mutagenesis using the QuickChange Lightning Site-Directed Mutagenesis kit (Agilent). For CD34+ HSPC cultures ...
-
bioRxiv - Biochemistry 2022Quote: ... constructs containing DNA encoding 8X-His-tagged CHI-domain-containing proteins were transformed into BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent) for recombinant protein expression ...
-
bioRxiv - Biophysics 2023Quote: Yeast eIF4G was purified as described previously.46 A pTYB2 vector encoding a C-terminal fusion of eIF4G with an intein and chitin-binding domain was transformed into BL21 CodonPlus RIL cells (Agilent). Protein expression was induced with 0.5 mM IPTG for overnight at 16 °C ...
-
bioRxiv - Immunology 2023Quote: ... in the α3 domain of HLA-A*02:01 described to abrogate binding of CD8 (13) were changed by site-directed mutagenesis (Agilent).
-
bioRxiv - Genetics 2023Quote: ... and the point mutations in the PWWP domain of DNMT3B (W263A, D266A, S270P, K276E and K294E) were introduced using the QuikChange II site-directed mutagenesis kit (Agilent). DNMT3BΔN starts from M200 and was generated by PCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... two cysteine to alanine point mutations (C115A/C118A) in the DNA binding domain were introduced using the QuikChange Site-directed Mutagenesis kit (Agilent Genomics) and the primers listed in Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2019Quote: ... the gene coding for the kinse domain of the Elk receptor was amplified from TKB1 cells (Agilent Technologies, Santa Clara, CA) and cloned with a C-terminal HA-tag between NdeI and EcoRV restriction sites within the second open reading frame of the pCDF-Duet vector ...
-
bioRxiv - Biochemistry 2021Quote: The removal of the C327-T331 segment from the CM domain of PniDAH7PS was performed using a QuikChange® II Site-Directed Mutagenesis Kit (Stratagene). The pET28a-PniDAH7PS plasmid was used as the template ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Cell Biology 2021Quote: ... and -ΔPID (aa 524-571) domain deletions were generated by PCR and the R57D mutant by the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent, 210518) according to the manufacturer’s instructions ...