Labshake search
Citations for Agilent :
1 - 50 of 678 citations for CD3D&CD3E Heterodimer Human HEK293 Fc Flag&Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... ScFv-Fc were revealed thanks to a polyclonal α-human IgG HRP-conjugated Ab (P0214, Dako), diluted 1:10000 ...
-
bioRxiv - Immunology 2022Quote: E382R/S/A mutations were introduced into IgG1 Fc encoded within a pFUSE-hIgG1-Fc vector using site-directed mutagenesis (QuikChange II kit, Agilent), using mutagenic primers (Supplementary Table 4 ...
-
bioRxiv - Neuroscience 2020Quote: ... human embryonic kidney cells 293 (HEK293; Agilent #240073) were calcium phosphate-transfected with the recombinant AAV2 plasmid and a 3-helper system ...
-
bioRxiv - Immunology 2019Quote: ... and CD3e (UCHT1, Dako). Secondary antibodies goat anti-rat AlexaFluor® 594 (1:200 ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... The N322Q mutation was introduced into ACE2-wt-Fc and ACE2-T92Q-Fc using the QuikChange Lightning Site-Directed-Mutagenesis kit (Agilent Technologies, United States) according to the manufacturer’s instructions and the respective parental vector as template ...
-
bioRxiv - Cancer Biology 2023Quote: ... After performing Fc block by using blocking buffer (Dako, X0909), cells were stained by CD24 (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... incubated with a rabbit antibody against mouse Fc fragment (Dako Agilent Z0412) in PBS 0,1% BSA for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... incubated with a rabbit antibody against mouse Fc fragment (Dako Agilent Z0412) in PBS 0,1% BSA for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary incubation was performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412), then grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary incubation was performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412), then grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Microbiology 2020Quote: ... ACE2-Fc variants were generated by the QuikChange II site-directed mutagenesis protocol (Agilent).
-
bioRxiv - Immunology 2021Quote: ... washed twice with PBS/2% FCS and stained with PE (Prozyme, 20 µg/ml). RNA flow cytometry measurement of Bhlhe40 expression was performed using the PrimeFlow RNA Assay (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: The library of the extracted genomic DNA was prepared by Illumina Nextera XT DNA Library Prep Kit protocol (# FC-131-1096) and analyzed by Agilent D1000 ScreenTape ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary incubation was next performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412). Grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary incubation was next performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412). Grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Physiology 2020Quote: ... blocked in 20% fetal calf serum (FCS) and incubated with anti-insulin (1/10, Dako) in Antibody Diluent for 2h ...
-
bioRxiv - Physiology 2020Quote: ... Slides were blocked with 20% FCS in PBS and incubated overnight with 1/10 anti-insulin (Dako) and 1/500 anti-Ki67 (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were resuspended in DMEM with 10% of FCS and transferred into xCELLigence microplates (E-plate 16, Agilent) at the density of 20 000 cells for real-time analysis of cell adhesion and growth ...
-
bioRxiv - Immunology 2021Quote: ... we changed three amino acids within the Fc region by using the QuikChange II site directed mutagenesis kits (Agilent, #200523), introducing M257Y ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1 μg/mL recombinant anti-PSD95 antibody (Rabbit Fc fusion, NanoTag Biotechnologies #N3783) diluted in Dako REAL Antibody Diluent (S2022, Agilent) for 1 h at RT ...
-
bioRxiv - Immunology 2024Quote: ... and MØ cell culture media was replaced with FCS-and bicarbonate-free DMEM medium supplemented with 4.5 mg ml-1 D-glucose and 2 mM glutamine (Agilent, USA) for another 60 min incubation at 37°C without CO2 ...
-
bioRxiv - Immunology 2021Quote: The KA and LALA mutations were introduced to the Fc fragment of 2219 by QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) according to the instruction manual ...
-
bioRxiv - Systems Biology 2021Quote: ... Sample fractions were continuously collected into 96 well plates by an Agilent 1100 Series Micro-FC G1364D micro fraction collector (Agilent Technologies, Germany). For each sample ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected into HEK293 cells (AAV293, Stratagene). After 3 days ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected into HEK293 cells (AAV293, Stratagene). After three days ...
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged human SLFN14 D249A was generated by site directed mutagenesis with the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) using reverse primer SS1 (5’-atccaccccaatgaggacatatcc-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... We performed exome sequencing in the child with neonatal diabetes and his consanguineous parents using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb). We analyzed the data with our established pipeline in the institute (Kuhnen ...
-
bioRxiv - Developmental Biology 2023Quote: ... We performed exome sequencing in the child with diabetes and his consanguineous parents and sibling using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb) and next-generation sequencing (Hiseq ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plasmids containing the C- and N-terminally His-tagged human ACSS2 DNA were transformed into BL21 (DE3) RIL competent cells (Agilent Technologies, Wilmington, DE) and were expressed in auto-inducing media ZYP-5052 overnight at 15°C with shaking at 225 rpm ...
-
bioRxiv - Neuroscience 2019Quote: ... and RepCap5 (Applied Viromics) were transfected to HEK293 cells (AAV293, Stratagene). After 3 days of incubation ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-FLAG (Agilent), mouse anti-GFP (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... Respirometry on HEK293 cells were performed on a SeaHorse XF Pro (Agilent) using the real-time ATP rate assay kit (103591-100 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... GIT2(ΔE)/Flag and the double-deletion GIT2(ΔBCE)/Flag using the QuikChange mutagenesis kit (Stratagene). The ΔBC primers were 5’- ACTGCAAGCAAAACAAACCGGCAGAAGCTTCAAACACTCCAGAGTGAAAATTCG and 5’- GCAATTTTCACTCTGGAGTGTTTGAAGCTTCTGCCGGTTTGTTTTGCTTGCAGT to delete amino acids 415-464 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 μL of AccuScript Hi-Fi (Agilent Technologies) was added up to a 10 μL volume ...
-
bioRxiv - Microbiology 2022Quote: ... A 300×7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Genomics 2023Quote: ... were used to assess the Hi-C libraries (Agilent). The libraries were sequenced at New York Genome Center (NYGC ...
-
bioRxiv - Systems Biology 2023Quote: ... A 300 × 7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-FLAG (#200474) was from Agilent. Anti-MAPK4 antibody was purchased from ABGENT (#7298b).
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vector was produced using HEK293 T-cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15 cm dishes (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vectors were produced using HEK293 T cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15-cm dishes (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV plasmids were co-transfected with a pDP6 helper plasmid into HEK293-AAV cells (Agilent). Cells were lysed 72 h after transfection and viral particles were purified using Iodixanol gradient followed by separation ion-exchange chromatography (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-FLAG (Agilent, 1:800 dilution), rabbit anti-V5 (GenScript ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG (mouse; Sigma-Aldrich or rat; Agilent), HA (rat ...
-
bioRxiv - Microbiology 2024Quote: ... and a 300×7.8 mm Hi-Plex Exchange column (Agilent, USA) was used to quantify glucose ...
-
bioRxiv - Cell Biology 2019Quote: ... and incubated overnight at 4°C with primary antibodies (rabbit anti-TMEM98, Proteintech, 1:1000; rabbit anti-FLAG polyclonal, Sigma, 1:2000; mouse anti-FLAG monoclonal M2, Stratagene 1:2000 ...
-
bioRxiv - Microbiology 2020Quote: ... and pCMVTag 4 expression control plasmid containing the firefly luciferase gene fused with the FLAG tag (luc-FLAG) were obtained from Stratagene. The plasmid 15cxCAT contained the interleukin-2 (IL-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), rabbit anti-4E-BP1 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), mouse anti-V5 (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... bound to monoclonal anti-Flag antibody (Agilent Technologies) for 5 hours at 4°C ...