Labshake search
Citations for Agilent :
1 - 50 of 2316 citations for Anti Myc magnetic beads since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: M280 anti-mouse magnetic beads were coupled to control mouse IgG2a (Dako) or mouse monoclonal anti-Ku antibodies (Thermo Scientific ...
-
bioRxiv - Genomics 2021Quote: ... Poly(A)+ mRNA was enriched with oligo (dT) magnetic beads and analyzed with BioAnalyzer-2100 (Agilent). Purified poly(A)+ mRNAs from samples of CA5d ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were purified using 0.7X of Agencourt AMPure XP Magnetic Beads and analyzed on a Bioanalyzer using High Sensitivity DNA kit (Agilent) to determine the distribution of fragment size ...
-
bioRxiv - Cancer Biology 2020Quote: ... MYC/8q24 (probe Y5410; DAKO A/S), and PDL1/9p24.1 (PDL1 ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was purified from total RNA using biotin-tagged poly dT oligonucleotides and streptavidin-coated magnetic beads and quality was assessed using an Agilent Technologies 2100 Bioanalyzer (Agilent, Santa Clara, CA).
-
bioRxiv - Cell Biology 2021Quote: ... was then mutated to either R to mimic deacetylated c-Myc (K323R) or Q to mimic acetylated c-Myc (K323Q) using QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, 200522-5) against pPHAGE-EF1α-HA-Puro-c-Myc ...
-
bioRxiv - Biochemistry 2022Quote: ... and capped with magnetic crimp cap (Agilent technologies, Germany). Dried samples were methoximated by the addition of methoxyamine hydrochloride (25 μL ...
-
bioRxiv - Immunology 2021Quote: ... beads were incubated with 5 μg/ml FITC-conjugated rabbit anti-human C1q (Dako, F0254).
-
bioRxiv - Microbiology 2021Quote: ... Strataclean beads (Agilent) were used to isolate proteins instead of TCA precipitation ...
-
bioRxiv - Cell Biology 2021Quote: ... NDE1 and RASAL2 were PCR-cloned into pCMV2B (Flag) and pCMV3B (Myc) constructs (Stratagene). Expression constructs for SCRIBBLE ...
-
bioRxiv - Cancer Biology 2019Quote: ... Immunohistochemical staining was performed using antibodies against MYC (clone L-26; DakoCytomation, Glostrup, Denmark) and BCL2 (clone 124 ...
-
bioRxiv - Immunology 2019Quote: ... Calibration beads were stained with F(ab’)2 FITC-Conjugated Goat Anti-Mouse immunoglobulins (Dako, F0479) at 1:50 dilution for 1 hr at 4°C ...
-
bioRxiv - Genetics 2019Quote: ... Ampure XP beads (Agilent) were used for cleanup steps and size selection ...
-
bioRxiv - Developmental Biology 2019Quote: ... while the MURF1 cDNA fragment was cloned into myc-tagged pCMV-Tag3 (Stratagene, CA, USA). These constructs were sequenced to ensure that no errors were introduced.
-
bioRxiv - Cell Biology 2023Quote: GFP-TRIM5α and myc-TBK1 were mutated using a site-directed mutagenesis kit (Agilent, 210518). All plasmid constructs generated in this study were validated by DNA sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... Myc-TRIM27 W184A/F186A/L189A was mutated with Quickchange II site-directed mutagenesis kit (Agilent). pDONR221-AZI2/NAP1 was synthesized by Invitrogen GeneArt services (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... A 2x FLAG tag was introduced upstream of the 2x myc tag by quikchange (Quikchange, Stratagene). Addgene plasmid #25361 was found to have the Arg50His variant not present in consensus Uniprot sequence (Q5S007 ...
-
bioRxiv - Genetics 2022Quote: ... purified (AMPure XP beads (Agilent)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The C18 resin beads (Agilent) were first washed with 50% ACN solution and then equilibrated with 0.5%TFA in 5% ACN solution ...
-
bioRxiv - Biochemistry 2024Quote: ... CaM-linked agarose beads (Agilent) were equilibrated in the same buffer before adding the FBA preparations and incubating for 5 min at room temp ...
-
bioRxiv - Immunology 2022Quote: ... Myc-NEU3 mutants were generated using a QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA) with the DNA oligomers GGGCCCCTTAAACCACTTATTGAATCCACACTACC for mutant 1 and CAGTTCACTTAGACTGGAAGATGAATCTGGAACAC for mutant 2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pEF-MYC RAF1 S471A was made using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies), Forward Primer ...
-
bioRxiv - Biochemistry 2019Quote: ... StrataClean™ beads (Agilent Technologies, UK) were used to adsorb proteins (29) ...
-
bioRxiv - Neuroscience 2020Quote: ... PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit, Agilent, 210515) to create PLCγ2-P522R-myc-DDK (P522R ...
-
bioRxiv - Cell Biology 2020Quote: ... Myc-CUL5-ΔNEDD8 (K724A/K727A/K728A) mutant was obtained using QuickChange Multi Site-Directed Mutagenesis kit from Agilent (#200514) using the primer shown in Table S5 ...
-
bioRxiv - Cancer Biology 2019Quote: Custom FISH probes targeting MYC promoter and enhancer were designed using the SureDesign custom oligo design tool from Agilent with homology to the regions of interest mined from the hg19 genome build using the default parameters of the SureDesign tool ...
-
bioRxiv - Cancer Biology 2022Quote: ... The resulting mix was incubated with 100 µl of prewashed (dry bead volume) calmodulin-Sepharose beads (Agilent Technologies) for 2 hours with gentle agitation at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... 70 μL of Strataclean beads (Agilent technologies) were added (10 μL beads/mL media ...
-
bioRxiv - Cell Biology 2020Quote: The Bub1 K795R allele was generated by a single-base substitution in full-length mouse Bub1 cDNA cloned into pcDNA3/Myc using site-directed mutagenesis (Stratagene), then subcloned into a pShuttleCMV vector as a BglII-NotI digest ...
-
bioRxiv - Cell Biology 2020Quote: ... The S135A mutant form of NS3 was generated using site-directed mutagenesis to create pCMV-Myc-NS3-S135A Brazilian ZIKV (QuikChange II, Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... The pcDNA3.1 ERG (GenBank accession. NM_182918) Myc-tagged construct was mutated using the QuickChange Lightning Multi SiteDirected Mutagenesis kit (Agilent: #210513). All primers were designed using the QuickChange Primer Design Program (Agilent ...
-
bioRxiv - Immunology 2019Quote: ... The density of HLA-C per bead was calculated using QIFIKIT calibration beads according to the manufacturer’s instructions (Dako, K0078). Calibration beads contained five populations of beads conjugated to different numbers of mouse immunoglobulin ...
-
bioRxiv - Neuroscience 2019Quote: ... containing full-length rat Syt1 and a preprotachykinin signal sequence cloned upstream of the Myc tag as described in ref.17 The F349A mutation was introduced using site directed mutagenesis (QuickChange, Agilent Technologies). Myc-tagged Syt1WT and Syt1F349 sequences were then subcloned into the lentiviral vector L309 (a gift from T ...
-
bioRxiv - Cancer Biology 2019Quote: ... magnetic resonance data were acquired with a 7 T horizontal magnet Agilent ASR 310 (Agilent Technologies Inc.) equipped with nested 205/120/HDS gradient insert and a bore size of 310 mm ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: Mutagenesis of His 359 and Glu 363 to Alanine in human MYC (MycHEA mutant) was performed using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies # 200519), according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: Both mutants K465A and R466A/K467A of human PDK1 were obtained by site-directed mutagenesis of the eGFP-myc-PDK1 and HA-PDK1-mCherry constructs [13] with the QuickChange mutagenesis kit (Agilent Technologies, Inc.). The oligos used for the mutagenesis were as follows ...
-
bioRxiv - Immunology 2024Quote: ... The final PCR products were purified by AMPure XP beads at a 0.8:1 bead to sample ratio and quality controlled by TapeStation (D1000, Agilent, cat# 5067-5584). The samples were pooled at equimolar concentrations and further purified by gel extraction and AMPure XP bead clean up.
-
bioRxiv - Microbiology 2019Quote: Extracted DNA was purified using Ampure XP beads (Agilent). 50ul DNA was vortexed with 90ul Ampure XP beads and washed twice with 80% ethanol before elution in 25ul molecular water ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Pooled PCR products were purified with AMPure beads (Agilent), and 5ng of the purified pools was barcoded with Fluidigm Access Array barcodes using AccuPrime II (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by incubation with 7 μl StrataClean beads (Agilent) for 16 h at 4°C with constant tumbling ...
-
bioRxiv - Microbiology 2020Quote: ... The quantification was performed using counting beads (cytocount “DakoCytomation,” a suspension of concentration-calibrated fluorescent microspheres) ...
-
bioRxiv - Cell Biology 2022Quote: ... were introduced into the plasmid pED-FLAG-LMAN1 and pcDNA-MCFD2-Myc separately using the QuickChange site-directed mutagenesis II XL kit from Agilent (Santa Clara, CA). FVIII mutant constructs Δ807–816 (deletion of amino acids 807-816 of FVIII ...
-
bioRxiv - Cancer Biology 2022Quote: ... a final inclusive cleanup was performed using SPRI beads (Agilent). SPRI beads were added to PCR product at a 1.2X ratio and incubated for 5 min ...
-
bioRxiv - Genetics 2020Quote: ... Amplification reaction products were purified by AMPure Beads Purification (Agilent).
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Genomics 2024Quote: ... The libraries were then purified using Ampure XP beads (Agilent), washed with Long fragment buffer and eluted in elution buffer for 1 hour ...
-
bioRxiv - Biochemistry 2021Quote: ... The NMR (Nuclear magnetic resonance) spectra were obtained using Agilent DirectDrive2 500 MHz (Agilent Technologies, Palo Alto, CA, USA) in deuterated chloroform (CDCl3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1:1000, ab183741, abcam; n-Myc: 1:500, 51705 Cell Signaling Technology; CD45: 1:1000, 70257 Cell Signaling Technology; CD3: 1:2000 A0452 Dako/Agilent) diluted in TBST+5% goat serum in a humid chamber overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... beads and quantified on the Bioanalyzer (Agilent Technologies, Santa Clara CA). Libraries were multiplexed and sequenced to a depth of 50 million 100bp paired reads on a NextSeq (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... packed with 2 mm Zorbax 80XDB C18 reverse phase beads (Agilent), was connected to the trap column for peptides separation ...