Labshake search
Citations for Agilent :
1 - 50 of 7386 citations for Anti FLAG M5 SAP Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-FLAG (Agilent), mouse anti-GFP (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-FLAG (#200474) was from Agilent. Anti-MAPK4 antibody was purchased from ABGENT (#7298b).
-
bioRxiv - Cell Biology 2019Quote: ... and incubated overnight at 4°C with primary antibodies (rabbit anti-TMEM98, Proteintech, 1:1000; rabbit anti-FLAG polyclonal, Sigma, 1:2000; mouse anti-FLAG monoclonal M2, Stratagene 1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-FLAG (Agilent, 1:800 dilution), rabbit anti-V5 (GenScript ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), rabbit anti-4E-BP1 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), mouse anti-V5 (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... bound to monoclonal anti-Flag antibody (Agilent Technologies) for 5 hours at 4°C ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... GIT2(ΔE)/Flag and the double-deletion GIT2(ΔBCE)/Flag using the QuikChange mutagenesis kit (Stratagene). The ΔBC primers were 5’- ACTGCAAGCAAAACAAACCGGCAGAAGCTTCAAACACTCCAGAGTGAAAATTCG and 5’- GCAATTTTCACTCTGGAGTGTTTGAAGCTTCTGCCGGTTTGTTTTGCTTGCAGT to delete amino acids 415-464 ...
-
bioRxiv - Microbiology 2023Quote: ... A rat anti-FLAG mAb was purchased from Agilent Technologies (Santa Clara ...
-
bioRxiv - Physiology 2022Quote: ... ABA abundance in xylem sap (ABAxyl) was analysed by liquid chromatography/mass spectrometry (LC MS/MS, Agilent 6410) [12].
-
bioRxiv - Molecular Biology 2020Quote: The plasmid pUHD-FLAG-H3.3K56R and pUHD-FLAG-H3.3K56Q were constructed using a Quick Change II Site-Directed Mutagenesis Kit (Agilent, CA, United States), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... the membranes were incubated with anti-FLAG antibody (Agilent, Cat# 200474-21) or anti β-actin (Cell Signaling ...
-
bioRxiv - Microbiology 2020Quote: ... 1:5,000 anti-mouse (for anti-FLAG) or 1:5000 anti-rabbit (for all the others) linked to peroxidase (Dako Agilent), and vizualized thanks to Clarity™ Western ECL substrate chemiluminescence reagent (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... 1:5,000 anti-mouse (for anti-FLAG) or 1:5000 anti-rabbit (for all the others) linked to peroxidase (Dako Agilent), and vizualized thanks to Clarity™ Western ECL substrate chemiluminescence reagent (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... A rat anti-FLAG monoclonal antibody (200474) was purchased from Agilent (Santa Clara, CA). MS2 capsid proteins were detected with a polyclonal rabbit antibody (ABE76-I ...
-
bioRxiv - Cell Biology 2020Quote: ... blocked with 5% skimmed milk and probed successively with anti-Flag (Agilent, 200474-21) and anti-Rat (Licor ...
-
bioRxiv - Neuroscience 2020Quote: Flag-TDP-43ΔNLSsiRes was generated using the QuickChange® II Site-Directed mutagenesis kit (Agilent Technologies) on pCS2-Flag-TDP-43WT (Kabashi et al. ...
-
bioRxiv - Biochemistry 2020Quote: All mutations in C100 FLAG were introduced by site-directed mutagenesis (QuickChange Lightning Site Directed Mutagenesis kit, Agilent) in pET 22b vector ...
-
bioRxiv - Microbiology 2020Quote: ... and p-dsbS(S239A)- flag were obtained using the QuikChange II site-directed mutagenesis kit (Stratagene, catalog#: 200518). For generating p-dsbR(D51A)-flag ...
-
bioRxiv - Cell Biology 2023Quote: ... containing an AgeI restriction site in the FLAG sequence created by site-directed mutagenesis (QuikChange Mutagenesis kit, Agilent) using oligonucleotides detailed in Reagents and Tools table.
-
bioRxiv - Cell Biology 2024Quote: ... FLAG (mouse; Sigma-Aldrich or rat; Agilent), HA (rat ...
-
bioRxiv - Cell Biology 2020Quote: ... The EXD2-M126A variant was created by site-directed mutagenesis of pDEST-EXD2_iso1-BirA*-FLAG construct using Quick Change Lightning kit (Stratagene).
-
bioRxiv - Immunology 2020Quote: ... The pcDNA3.1 Flag-STING-C206S construct was generated using the Quikchange Lightning Site-Directed Mutagenesis kit from Agilent (#210518) with the following primer (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The Flag-tagged PARP1 R138C mutant was generated by the site-directed mutagenesis Kit (Agilent, La Jolla, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... SIK3-Flag-S884A and S884D plasmids were generated by introducing site-directed mutations into SIK3-Flag plasmid using the QuikChange II XL site-directed mutagenesis kit according to manufacturer’s instruction (Agilent). Lenti-Puro-SIK3-Flag plasmid was constructed by subcloning the “mSIK3-3xFlag” coding sequences (CDS ...
-
bioRxiv - Neuroscience 2023Quote: EEF1A2 mutations in both the CMV-NGFP-EEF1A2-Neo vector and the pcDNA3.1-CMV-Flag-EEF1A2 vector were generated using the QuikChange II site directed mutagenesis kit (Agilent) according to the manufacturers protocol using the following primers.
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: ... The purified PCR products were subsequently used as megaprimers to generate the library of mutants in the plasmid pZE-ProQ-3×FLAG by following GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) guidelines ...
-
bioRxiv - Cell Biology 2021Quote: ... RUVBL2 and siRNA-resistant RUVBL2 ATPase mutant (E300G) were constructed by site-directed mutagenesis of Flag-TIP49b (RUVBL2) using QuikChange site-directed mutagenesis kit (Agilent). His-NFAT5171-250-AcGFP ...
-
bioRxiv - Biochemistry 2021Quote: ... Cys to Ala mutants of Flag-tagged DJ-1 were using QuikChange Ⅱ Site-Directed Mutagenesis kit (Agilent Technologies, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged human SLFN14 D249A was generated by site directed mutagenesis with the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) using reverse primer SS1 (5’-atccaccccaatgaggacatatcc-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... and pCMVTag 4 expression control plasmid containing the firefly luciferase gene fused with the FLAG tag (luc-FLAG) were obtained from Stratagene. The plasmid 15cxCAT contained the interleukin-2 (IL-2 ...
-
bioRxiv - Genomics 2021Quote: ... anti-CD117 (clone c-kit, DAKO). The molecular markers of immune panel (CD3 ...
-
PHF2 regulates homology-directed DNA repair by controlling the resection of DNA double strand breaksbioRxiv - Molecular Biology 2019Quote: ... Three silent mutations (in capital, gctggaGatCAgGgagcaa) were introduced in the Flag-PHF2 plasmid using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) to make it resistant to siRNA oligonucleotide PHF2#1 (Flag-PHF2*) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Point mutants for ENDOD1 and TP53 were converted from parental pLVX-Flag -IRES-ZsGreen1 plasmids using QuikChange Lightning Site-Directed Mutagenesis Kits (Stratagene, 200519). Truncations of ENDOD1 and mutations of TP53 were obtained by fusing different PCR fragments using In-Fusion cloning kit (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... The enzymatically-inactive pCAGGS-TMPRSS2(S441A)FLAG mutant cDNA was generated using QuickChange Site-Directed Mutagenesis Kit per manufacturer instructions (Agilent Technologies). Transient transfections of HEK-293T cells were performed using PolyFect transfection reagent per manufacturer instructions (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Site-specific mutation of K674R was introduced in pQCXIP-FLAG-MD by using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... p.C131S active site dominant negative (DN) missense mutation was introduced into pCMV-UBE2E1-FLAG-cmyc using the QuickChange mutagenesis kit (Stratagene Inc.) and verified by DNA sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... Twin-strep-Flag-HALO-DVL3 or pCS2+xDvl3 vector was performed using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) following a manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The substitution S59D and S59A were introduced into the pLVX-IRES-FLAG-tagged HERPUD1 vector using the QuikChange II XL direct-mutagenesis kit (Stratagene, cat#200522) and the mutagenesis service of GenScript (Hong Kong ...
-
bioRxiv - Cancer Biology 2020Quote: ... The anti-rabbit EnVision kit (Agilent, CA) was used for signal amplification ...
-
bioRxiv - Cell Biology 2022Quote: ... were introduced into the plasmid pED-FLAG-LMAN1 and pcDNA-MCFD2-Myc separately using the QuickChange site-directed mutagenesis II XL kit from Agilent (Santa Clara, CA). FVIII mutant constructs Δ807–816 (deletion of amino acids 807-816 of FVIII ...
-
bioRxiv - Cell Biology 2020Quote: ... Flag-ErbB3 cDNA was subjected to site-directed mutagenesis (Agilent) to generate LL866/7AA mutant Flag-ErbB3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The rat monoclonal to flag tag (Agilent Cat# 200474, RRID:AB_10597743). The monoclonal to Xenopus laevis Sox3 (DSHB Cat# DA5H6 ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned and inserted into pCMV5-FLAG vector (Agilent Technology). The mouse SVZ cDNA was prepared as described in the ‘qPCR analysis of migrating neurons’ section ...
-
bioRxiv - Cell Biology 2023Quote: ... FLAG-Trabid mutants generated by site-directed mutagenesis (QuikChange, Agilent), pEGFP-C1-APC (Rosin-Arbesfeld et al ...
-
bioRxiv - Microbiology 2021Quote: ... Mutations were introduced into Flag-CinBwNo in p416GAL1 by Quikchange (Agilent; mutagenesis using primers listed in Supplementary Table 2).
-
bioRxiv - Synthetic Biology 2023Quote: ... Immunodetection was carried out by blocking PVDF membranes in 5% (w/v) fat-free dried milk powder followed by incubation overnight in rat anti-FLAG antibodies diluted 1:500 (Agilent Technologies, Santa Clara, CA, USA). After a brief rinse in Tris-buffered saline with Tween™ 20 detergent (TBST) ...
-
bioRxiv - Immunology 2019Quote: ... FLAG-RNF144A C198A was generated by site-directed mutagenesis using Quickchange (Stratagene) with primers X and X ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Microbiology 2023Quote: ... α-FLAG MAb (rat) (M2) was purchased from Agilent (Santa Clara, CA). α-HA MAb (mouse) ...