Labshake search
Citations for Agilent :
1 - 50 of 757 citations for 7 METHOXY CHROMAN 3 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Cell Biology 2019Quote: ... Fatty acid methyl esters were detected by GC-MS (Agilent 5977A-7890B) according to the method described in Ramakrishnan et al ...
-
bioRxiv - Plant Biology 2019Quote: ... The resulting fatty acid methyl esters were analyzed using GC/MS (Agilent Technologies, Wilmington, DE) equipped with a capillary DB-23 column (30 m × 0.25 mm × 0.25 μm ...
-
bioRxiv - Plant Biology 2023Quote: ... Lipid bands were scratched from the plates and their fatty acids extracted (fatty acid methyl esters FAMEs) and quantified by GC-MS (Agilent 7890 A and MSD 5975 Agilent EI) as in (39) ...
-
bioRxiv - Microbiology 2021Quote: ... Fatty acid methyl esters were identified by their mass spectrum and retention time and quantified by Mass Hunter Quantification Software (Agilent) and the calibration curve generated with fatty acid methyl esters standards mix (Sigma CRM47885) ...
-
bioRxiv - Microbiology 2021Quote: ... The extracted phospholipids were methanolized as fatty-acid methyl esters and then analysed using gas chromatography (Agilent Technologies 6890N, UK) [26] ...
-
bioRxiv - Developmental Biology 2021Quote: ... The biodiesel obtained was stored and the amount of fatty acid methyl esters (FAMEs) were determined using a gas chromatography mass spectrometer (GCMS)(Agilent systems). The conditions used include hydrogen as the carrier gas with a flow rate of 40ml/minutes ...
-
bioRxiv - Microbiology 2020Quote: Fatty acid methyl esters were obtained as previously described [17] and separated by using a gas chromatograph (model 6890 N; Agilent Technologies). Peaks were automatically computed and assigned using the Microbial Identification software package (MIDI) ...
-
bioRxiv - Synthetic Biology 2023Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Plant Biology 2023Quote: ... Lipid bands were scratched from the plates and their fatty acids extracted (fatty acid methyl esters FAMEs) and quantified by GC-MS (Agilent 7890 A and MSD 5975 Agilent EI) as in (39) ...
-
bioRxiv - Evolutionary Biology 2020Quote: The methyl ester samples were subjected to GC-MS analysis on a Hewlett Packard 6890 GC (Agilent) coupled to a mass selective detector HP 5973 (Agilent) ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse methyl capture sequencing (Methyl-Seq) libraries were generated using the SureSelectXT Methyl-Seq Target Enrichment System (Agilent, Santa Clara, CA, USA, #G9651B) and the SureSelectXT Mouse Methyl-Seq target enrichment panel (Agilent ...
-
bioRxiv - Zoology 2024Quote: ... The resulting esters were analyzed by Agilent GC-FID ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Physiology 2020Quote: ... Cell nuclei were counter-stained in methyl green (Dako). Specimens were then dehydrated in series of ethanol and xylene ...
-
bioRxiv - Developmental Biology 2023Quote: ... was used to produce Methyl-Seq libraries using a SureSelectXT Methyl-Seq Target Enrichment System with a mouse enrichment panel (Agilent #G9651B and #5191-6704) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... and SureSelectXT Mouse Methyl-Seq Reagent Kit (Agilent Catalog # 931052) ...
-
bioRxiv - Synthetic Biology 2019Quote: Esters were measured by GC (HP 6890, Agilent, CA, USA) equipped with a MS (HP 5973 ...
-
bioRxiv - Synthetic Biology 2022Quote: Esters were quantified by GC (HP 6890, Agilent, CA, USA) equipped with a MS (HP 5973 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... CoA-esters were purified by using HPLC 1260 Infinity (Agilent), equipped with Gemini 10 μm NX-C18 110 Å Column (Phenomenex) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... As described in manufacturer’s protocol (Agilent SureSelectXT Mouse Methyl-Seq Kit), bisulfite converted libraries were PCR-amplified for 8 cycles with supplied universal primers and purified using AMPure XP beads ...
-
bioRxiv - Cell Biology 2021Quote: ... and 299.294 m/z (Methyl Stearate; Agilent article number G1982-85003) were used to recalibrate spectra during the acquisition.
-
bioRxiv - Synthetic Biology 2021Quote: 2-methyl tryptophan was quantified by an LC-MS system (Agilent) using an XBridge BEH Amide 2.5 μm (Waters ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the SureSelectXT Mouse Methyl-Seq target enrichment panel (Agilent, #5191-6704) following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Fatty esters were analyzed on an Agilent GCMS 5975/7890 (Agilent Technologies) using an DB-35MS column ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting 1-O-methyl-glycoside TMS derivatives were analysed by GC-MS (Agilent Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... The digestion and desalting (total time 3 min) were driven by 0.4% formic acid (FA) in water pumped by 1260 Infinity II Quaternary pump (Agilent Technologies, Waldbronn, Germany) at a flow rate of 100 μL·min−1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were then further diluted in ultrapure water to a final 3% nitric acid concentration and analyzed by triple quadrupole inductively coupled plasma-mass spectrometry (Agilent 8800 ICP-QQQ). Copper concentrations were determined by using standard curves ...
-
bioRxiv - Biochemistry 2021Quote: ... The 1-O-methyl-glycoside TMS derivatives and the PMAAs were analysed by GC-MS (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... libraries were prepared using the SureSelect Methyl-Seq Library Prep Kit ILM (Agilent Catalog # 5500-0128) included the indices for pooled sequencing ...
-
bioRxiv - Genomics 2023Quote: Eight library preparations were carried out using the SureSelect Methyl-Seq Target Enrichment kit (Agilent, G9651) following the manufacturer’s protocol (User guide ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... were diluted with ultra-pure water to reduce the acid concentration below 3% and loaded into the ICP-MS-MS (triple quad Agilent 8800x ICP-MS-MS). The instrumental conditions were optimized to remove interferences by using a collision/reaction cell ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Bioengineering 2021Quote: ... The GC-MS system used was the 7890-5975C from Agilent in combination with the HP-5MS column (5% phenyl methyl polysiloxane, 30m×0.25mm ID, 0.25µm) from Agilent. The temperature was maintained at 180 °C for 1 min ...