Labshake search
Citations for Agilent :
1 - 50 of 792 citations for 7 Iodobenzofuran 5 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Pathology 2023Quote: ... Antigen retrieval was carried out using Proteinase K (5 μg/ml, 7 mins, Dako, UK). Sections were rinsed in running tap water for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 min at room temperature prior to recording fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 488 nm and measuring emission at 535 nm ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2022Quote: ... Volatiles were eluted in methylene chloride and analyzed using GC-MS (GC: Agilent 7890B ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Biochemistry 2020Quote: ... linear gradient from 5% to 35% ACN in 50 mM TEAAc pH 7 over 15 min at 50 °C, Agilent Technologies Series 1200 HPLC). The collected fractions were freeze dried 3 times ...
-
bioRxiv - Plant Biology 2022Quote: ... Volatiles were eluted in methylene chloride and analyzed using GC-MS (GC: Agilent 7890B, MS: Agilent 5977B ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Cancer Biology 2019Quote: ... for p53 (clone DO-7, Dako, Carpinteria, California, USA) at 1:50 dilution and for Pax8 (clone MRQ-50 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by incubation with 7 μl StrataClean beads (Agilent) for 16 h at 4°C with constant tumbling ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... then assessed RNA quality using TapeStation (Agilent Technologies; RIN > 7). The Genome Sequencing and Analysis Facility at the University of Texas at Austin prepared TagSeq libraries ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity (RINe ≥ 7) was confirmed using Tapestation 4200 (Agilent). The median RINe score was 9.2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Plant Biology 2022Quote: ... Volatiles were eluted in methylene chloride and analyzed using GC-MS (GC: Agilent 7890B, MS: Agilent 5977B, column: Agilent DB-35MS [length ...
-
bioRxiv - Cancer Biology 2021Quote: ... The reaction mix was purified by lithium chloride precipitation and concentration and size of the transcripts were measured using TapeStation 4200 (Agilent).
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 µl of protein sample in assay buffer (20 mM sodium phosphate, 20 mM sodium chloride, pH 8) was injected onto a C4 column (Agilent) and eluted in a water (1% FA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Neuroscience 2021Quote: ... Images were acquired on a 7 Tesla MRI scanner (Agilent Inc.) (23 ...
-
bioRxiv - Immunology 2023Quote: ... or R-phycoerythrin-cyanine-7 (PE-Cy7) fluorochromes (Prozyme, Thermo-Fisher).
-
bioRxiv - Microbiology 2019Quote: ... Good quality RNA (RIN > 7, assessed by a Bioanalyzer 2100 (Agilent Technologies)) from total RNA and rRNA-subtracted RNA were converted to cDNA as described by (49 ...
-
bioRxiv - Immunology 2021Quote: A multi-channel 7 Tesla MRI scanner (Agilent Inc., Palo Alto, CA) was used to image brains in skulls ...
-
bioRxiv - Genetics 2019Quote: ... The libraries were amplified 7× using Herculase II Fusion Polymerase kit (Agilent).
-
bioRxiv - Neuroscience 2023Quote: ... At day 7 of differentiation astrocytes were switched to XF media (Agilent) and then assessed using the previously described Mitochondrial Stress Test Protocol [24] ...
-
bioRxiv - Molecular Biology 2021Quote: ... was generated from a 7-kb genomic clone from Lambda FIX Library (Stratagene) (Supplemental Fig ...
-
bioRxiv - Neuroscience 2019Quote: ... T2-weighted RARE images were acquired on a 7-T scanner (Varian/Agilent) with imaging parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA quality (RIN > 7) was confirmed using an RNA 6000 Nano Kit (Agilent). Spatial gene expression slides were processed following manufacturer instructions (Visium Spatial Gene Expression Reagent Kits User Guide ...
-
bioRxiv - Neuroscience 2022Quote: ... Postmortem data were then acquired on an 7 T small animal scanner (Agilent) fitted with a 40 G/cm gradient coil (Agilent ...
-
bioRxiv - Immunology 2023Quote: ... or cyan-7 conjugated R-phycoerythrin (PECy7) fluorochrome-conjugated streptavidin (Prozyme, Thermo-Fisher).
-
bioRxiv - Cancer Biology 2019Quote: TP53 Immunohistochemistry was performed with the mouse monoclonal antibody Do-7 (Dako, Glostrup, Denmark), according to standard protocols.
-
bioRxiv - Neuroscience 2021Quote: A 7 T horizontal small-bore magnet and (Agilent Technologies Inc, Santa Clara, USA) and a quadrature volume radiofrequency coil (39 mm internal diameter ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples with RIN values above 7 in the Bioanalyzer RNA 6000 Nano assay (Agilent) were used for the synthesis of complementary DNA and RT controls using a reverse transcription TATAA GrandScript cDNA Synthesis Kit (TATAA Biocenter) ...
-
bioRxiv - Cancer Biology 2022Quote: ... RIN (7-10) was calculated by capillary electrophoresis in a Bioanalizer (Agilent, Waldbronn, Germany). 2.5 µg (100 ng/µL ...
-
bioRxiv - Cancer Biology 2023Quote: ... RIN (7-10) was calculated by capillary electrophoresis in a Bioanalyzer (Agilent, Waldbronn, Germany).
-
PRC1 directs PRC2-H3K27me3 deposition to shield adult spermatogonial stem cells from differentiationbioRxiv - Developmental Biology 2023Quote: ... 7-µm-thick paraffin sections were deparaffinized and autoclaved in target retrieval solution (DAKO) for 10 min at 121°C ...
-
bioRxiv - Genomics 2024Quote: ... the integrity (RIN > 7) and concentration (ng/µl) were accessed using Bioanalyzer 2100 (Agilent). At last ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 µm (Agilent). Next ...